ID: 1142254970

View in Genome Browser
Species Human (GRCh38)
Location 16:89009309-89009331
Sequence AAAGATGAGGTGGGTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142254970_1142254977 6 Left 1142254970 16:89009309-89009331 CCTGACACACCCACCTCATCTTT No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254970_1142254978 7 Left 1142254970 16:89009309-89009331 CCTGACACACCCACCTCATCTTT No data
Right 1142254978 16:89009339-89009361 GACCCATGACACCTGGCCTTGGG No data
1142254970_1142254976 0 Left 1142254970 16:89009309-89009331 CCTGACACACCCACCTCATCTTT No data
Right 1142254976 16:89009332-89009354 GCAGGAGGACCCATGACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142254970 Original CRISPR AAAGATGAGGTGGGTGTGTC AGG (reversed) Intergenic