ID: 1142254973

View in Genome Browser
Species Human (GRCh38)
Location 16:89009318-89009340
Sequence TCCTCCTGCAAAGATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142254973_1142254976 -9 Left 1142254973 16:89009318-89009340 CCCACCTCATCTTTGCAGGAGGA No data
Right 1142254976 16:89009332-89009354 GCAGGAGGACCCATGACACCTGG No data
1142254973_1142254978 -2 Left 1142254973 16:89009318-89009340 CCCACCTCATCTTTGCAGGAGGA No data
Right 1142254978 16:89009339-89009361 GACCCATGACACCTGGCCTTGGG No data
1142254973_1142254983 26 Left 1142254973 16:89009318-89009340 CCCACCTCATCTTTGCAGGAGGA No data
Right 1142254983 16:89009367-89009389 CTCCTTGCTCCTCTTTTCCTCGG No data
1142254973_1142254984 27 Left 1142254973 16:89009318-89009340 CCCACCTCATCTTTGCAGGAGGA No data
Right 1142254984 16:89009368-89009390 TCCTTGCTCCTCTTTTCCTCGGG No data
1142254973_1142254977 -3 Left 1142254973 16:89009318-89009340 CCCACCTCATCTTTGCAGGAGGA No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142254973 Original CRISPR TCCTCCTGCAAAGATGAGGT GGG (reversed) Intergenic