ID: 1142254975

View in Genome Browser
Species Human (GRCh38)
Location 16:89009322-89009344
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142254975_1142254983 22 Left 1142254975 16:89009322-89009344 CCTCATCTTTGCAGGAGGACCCA No data
Right 1142254983 16:89009367-89009389 CTCCTTGCTCCTCTTTTCCTCGG No data
1142254975_1142254978 -6 Left 1142254975 16:89009322-89009344 CCTCATCTTTGCAGGAGGACCCA No data
Right 1142254978 16:89009339-89009361 GACCCATGACACCTGGCCTTGGG No data
1142254975_1142254977 -7 Left 1142254975 16:89009322-89009344 CCTCATCTTTGCAGGAGGACCCA No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254975_1142254984 23 Left 1142254975 16:89009322-89009344 CCTCATCTTTGCAGGAGGACCCA No data
Right 1142254984 16:89009368-89009390 TCCTTGCTCCTCTTTTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142254975 Original CRISPR TGGGTCCTCCTGCAAAGATG AGG (reversed) Intergenic