ID: 1142254977

View in Genome Browser
Species Human (GRCh38)
Location 16:89009338-89009360
Sequence GGACCCATGACACCTGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142254970_1142254977 6 Left 1142254970 16:89009309-89009331 CCTGACACACCCACCTCATCTTT No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254969_1142254977 7 Left 1142254969 16:89009308-89009330 CCCTGACACACCCACCTCATCTT No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254966_1142254977 30 Left 1142254966 16:89009285-89009307 CCACCTCATCTGTGCCAGGAGGA No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254968_1142254977 16 Left 1142254968 16:89009299-89009321 CCAGGAGGACCCTGACACACCCA No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254975_1142254977 -7 Left 1142254975 16:89009322-89009344 CCTCATCTTTGCAGGAGGACCCA No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254973_1142254977 -3 Left 1142254973 16:89009318-89009340 CCCACCTCATCTTTGCAGGAGGA No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254974_1142254977 -4 Left 1142254974 16:89009319-89009341 CCACCTCATCTTTGCAGGAGGAC No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254967_1142254977 27 Left 1142254967 16:89009288-89009310 CCTCATCTGTGCCAGGAGGACCC No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142254977 Original CRISPR GGACCCATGACACCTGGCCT TGG Intergenic