ID: 1142259249

View in Genome Browser
Species Human (GRCh38)
Location 16:89034915-89034937
Sequence GCAGGGCCTGTGTTGAGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142259240_1142259249 8 Left 1142259240 16:89034884-89034906 CCACAGGGCTTGTAGAGGCAGGT No data
Right 1142259249 16:89034915-89034937 GCAGGGCCTGTGTTGAGGCCGGG No data
1142259234_1142259249 29 Left 1142259234 16:89034863-89034885 CCTCTGTCCTGGAGAAAGTGGCC No data
Right 1142259249 16:89034915-89034937 GCAGGGCCTGTGTTGAGGCCGGG No data
1142259237_1142259249 22 Left 1142259237 16:89034870-89034892 CCTGGAGAAAGTGGCCACAGGGC No data
Right 1142259249 16:89034915-89034937 GCAGGGCCTGTGTTGAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142259249 Original CRISPR GCAGGGCCTGTGTTGAGGCC GGG Intergenic