ID: 1142261036

View in Genome Browser
Species Human (GRCh38)
Location 16:89042540-89042562
Sequence AGGGTGCAGCGATGGGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142261024_1142261036 11 Left 1142261024 16:89042506-89042528 CCAGGCGTGTGGATGGGCGCGGG No data
Right 1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG No data
1142261022_1142261036 12 Left 1142261022 16:89042505-89042527 CCCAGGCGTGTGGATGGGCGCGG No data
Right 1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142261036 Original CRISPR AGGGTGCAGCGATGGGCGCG GGG Intergenic
No off target data available for this crispr