ID: 1142261046

View in Genome Browser
Species Human (GRCh38)
Location 16:89042573-89042595
Sequence AGGGTGCAGCGATGGGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142261032_1142261046 16 Left 1142261032 16:89042534-89042556 CCTGCCAGGGTGCAGCGATGGGC No data
Right 1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG No data
1142261033_1142261046 12 Left 1142261033 16:89042538-89042560 CCAGGGTGCAGCGATGGGCGCGG No data
Right 1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142261046 Original CRISPR AGGGTGCAGCGATGGGCGCG GGG Intergenic
No off target data available for this crispr