ID: 1142261056

View in Genome Browser
Species Human (GRCh38)
Location 16:89042606-89042628
Sequence AGGGTGCAGCGATGGGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142261043_1142261056 12 Left 1142261043 16:89042571-89042593 CCAGGGTGCAGCGATGGGCGCGG No data
Right 1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG No data
1142261042_1142261056 16 Left 1142261042 16:89042567-89042589 CCTGCCAGGGTGCAGCGATGGGC No data
Right 1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142261056 Original CRISPR AGGGTGCAGCGATGGGCGCG GGG Intergenic
No off target data available for this crispr