ID: 1142261066

View in Genome Browser
Species Human (GRCh38)
Location 16:89042639-89042661
Sequence AGGGTGCAGCGATGGGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142261053_1142261066 12 Left 1142261053 16:89042604-89042626 CCAGGGTGCAGCGATGGGCGCGG No data
Right 1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG No data
1142261052_1142261066 16 Left 1142261052 16:89042600-89042622 CCTGCCAGGGTGCAGCGATGGGC No data
Right 1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142261066 Original CRISPR AGGGTGCAGCGATGGGCGCG GGG Intergenic
No off target data available for this crispr