ID: 1142261076

View in Genome Browser
Species Human (GRCh38)
Location 16:89042672-89042694
Sequence AGGGTGCAGCGATGGGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142261063_1142261076 12 Left 1142261063 16:89042637-89042659 CCAGGGTGCAGCGATGGGCGCGG No data
Right 1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG No data
1142261062_1142261076 16 Left 1142261062 16:89042633-89042655 CCTGCCAGGGTGCAGCGATGGGC No data
Right 1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142261076 Original CRISPR AGGGTGCAGCGATGGGCGCG GGG Intergenic
No off target data available for this crispr