ID: 1142262620

View in Genome Browser
Species Human (GRCh38)
Location 16:89049989-89050011
Sequence CTGTGAAATTCGGAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142262613_1142262620 1 Left 1142262613 16:89049965-89049987 CCGAGCCGGCGCGGGAAGCAGGG No data
Right 1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG No data
1142262615_1142262620 -4 Left 1142262615 16:89049970-89049992 CCGGCGCGGGAAGCAGGGACTGT No data
Right 1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142262620 Original CRISPR CTGTGAAATTCGGAGGTGGA GGG Intergenic
No off target data available for this crispr