ID: 1142263226

View in Genome Browser
Species Human (GRCh38)
Location 16:89052100-89052122
Sequence CCCAGATGGTCCCCAAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142263226_1142263236 15 Left 1142263226 16:89052100-89052122 CCAACATTTGGGGACCATCTGGG No data
Right 1142263236 16:89052138-89052160 GGGCAGAGGAGACCTGGCCCTGG No data
1142263226_1142263238 17 Left 1142263226 16:89052100-89052122 CCAACATTTGGGGACCATCTGGG No data
Right 1142263238 16:89052140-89052162 GCAGAGGAGACCTGGCCCTGGGG No data
1142263226_1142263239 18 Left 1142263226 16:89052100-89052122 CCAACATTTGGGGACCATCTGGG No data
Right 1142263239 16:89052141-89052163 CAGAGGAGACCTGGCCCTGGGGG No data
1142263226_1142263237 16 Left 1142263226 16:89052100-89052122 CCAACATTTGGGGACCATCTGGG No data
Right 1142263237 16:89052139-89052161 GGCAGAGGAGACCTGGCCCTGGG No data
1142263226_1142263234 1 Left 1142263226 16:89052100-89052122 CCAACATTTGGGGACCATCTGGG No data
Right 1142263234 16:89052124-89052146 GACTATACGGAACTGGGCAGAGG No data
1142263226_1142263235 9 Left 1142263226 16:89052100-89052122 CCAACATTTGGGGACCATCTGGG No data
Right 1142263235 16:89052132-89052154 GGAACTGGGCAGAGGAGACCTGG No data
1142263226_1142263242 27 Left 1142263226 16:89052100-89052122 CCAACATTTGGGGACCATCTGGG No data
Right 1142263242 16:89052150-89052172 CCTGGCCCTGGGGGCCCACAGGG No data
1142263226_1142263240 26 Left 1142263226 16:89052100-89052122 CCAACATTTGGGGACCATCTGGG No data
Right 1142263240 16:89052149-89052171 ACCTGGCCCTGGGGGCCCACAGG No data
1142263226_1142263233 -5 Left 1142263226 16:89052100-89052122 CCAACATTTGGGGACCATCTGGG No data
Right 1142263233 16:89052118-89052140 CTGGGGGACTATACGGAACTGGG No data
1142263226_1142263232 -6 Left 1142263226 16:89052100-89052122 CCAACATTTGGGGACCATCTGGG No data
Right 1142263232 16:89052117-89052139 TCTGGGGGACTATACGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142263226 Original CRISPR CCCAGATGGTCCCCAAATGT TGG (reversed) Intergenic
No off target data available for this crispr