ID: 1142263909

View in Genome Browser
Species Human (GRCh38)
Location 16:89054833-89054855
Sequence GAGCTCCTCCGCCGAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142263907_1142263909 -7 Left 1142263907 16:89054817-89054839 CCCTGAAATGTTCTGGGAGCTCC No data
Right 1142263909 16:89054833-89054855 GAGCTCCTCCGCCGAAGCCCTGG No data
1142263902_1142263909 14 Left 1142263902 16:89054796-89054818 CCACACGGGCCTTCTTGCTGCCC No data
Right 1142263909 16:89054833-89054855 GAGCTCCTCCGCCGAAGCCCTGG No data
1142263901_1142263909 17 Left 1142263901 16:89054793-89054815 CCACCACACGGGCCTTCTTGCTG No data
Right 1142263909 16:89054833-89054855 GAGCTCCTCCGCCGAAGCCCTGG No data
1142263908_1142263909 -8 Left 1142263908 16:89054818-89054840 CCTGAAATGTTCTGGGAGCTCCT No data
Right 1142263909 16:89054833-89054855 GAGCTCCTCCGCCGAAGCCCTGG No data
1142263903_1142263909 5 Left 1142263903 16:89054805-89054827 CCTTCTTGCTGCCCCTGAAATGT No data
Right 1142263909 16:89054833-89054855 GAGCTCCTCCGCCGAAGCCCTGG No data
1142263906_1142263909 -6 Left 1142263906 16:89054816-89054838 CCCCTGAAATGTTCTGGGAGCTC No data
Right 1142263909 16:89054833-89054855 GAGCTCCTCCGCCGAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142263909 Original CRISPR GAGCTCCTCCGCCGAAGCCC TGG Intergenic
No off target data available for this crispr