ID: 1142264046

View in Genome Browser
Species Human (GRCh38)
Location 16:89055446-89055468
Sequence CTGACTCAGCCCATCTGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142264046_1142264056 12 Left 1142264046 16:89055446-89055468 CCCCGACAGATGGGCTGAGTCAG No data
Right 1142264056 16:89055481-89055503 GAGAGTCAGCACCCTGCTGCCGG No data
1142264046_1142264057 16 Left 1142264046 16:89055446-89055468 CCCCGACAGATGGGCTGAGTCAG No data
Right 1142264057 16:89055485-89055507 GTCAGCACCCTGCTGCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142264046 Original CRISPR CTGACTCAGCCCATCTGTCG GGG (reversed) Intergenic
No off target data available for this crispr