ID: 1142264046 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:89055446-89055468 |
Sequence | CTGACTCAGCCCATCTGTCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142264046_1142264056 | 12 | Left | 1142264046 | 16:89055446-89055468 | CCCCGACAGATGGGCTGAGTCAG | No data | ||
Right | 1142264056 | 16:89055481-89055503 | GAGAGTCAGCACCCTGCTGCCGG | No data | ||||
1142264046_1142264057 | 16 | Left | 1142264046 | 16:89055446-89055468 | CCCCGACAGATGGGCTGAGTCAG | No data | ||
Right | 1142264057 | 16:89055485-89055507 | GTCAGCACCCTGCTGCCGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142264046 | Original CRISPR | CTGACTCAGCCCATCTGTCG GGG (reversed) | Intergenic | ||
No off target data available for this crispr |