ID: 1142266873

View in Genome Browser
Species Human (GRCh38)
Location 16:89068016-89068038
Sequence TGCCTGCCCGGGGGCTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142266860_1142266873 19 Left 1142266860 16:89067974-89067996 CCAGAGCAGCTGGGCCCGGTGCC No data
Right 1142266873 16:89068016-89068038 TGCCTGCCCGGGGGCTCCTGAGG No data
1142266861_1142266873 5 Left 1142266861 16:89067988-89068010 CCCGGTGCCAGCAGCCCTGCCCC No data
Right 1142266873 16:89068016-89068038 TGCCTGCCCGGGGGCTCCTGAGG No data
1142266862_1142266873 4 Left 1142266862 16:89067989-89068011 CCGGTGCCAGCAGCCCTGCCCCT No data
Right 1142266873 16:89068016-89068038 TGCCTGCCCGGGGGCTCCTGAGG No data
1142266859_1142266873 20 Left 1142266859 16:89067973-89067995 CCCAGAGCAGCTGGGCCCGGTGC No data
Right 1142266873 16:89068016-89068038 TGCCTGCCCGGGGGCTCCTGAGG No data
1142266864_1142266873 -9 Left 1142266864 16:89068002-89068024 CCCTGCCCCTAATCTGCCTGCCC No data
Right 1142266873 16:89068016-89068038 TGCCTGCCCGGGGGCTCCTGAGG No data
1142266865_1142266873 -10 Left 1142266865 16:89068003-89068025 CCTGCCCCTAATCTGCCTGCCCG No data
Right 1142266873 16:89068016-89068038 TGCCTGCCCGGGGGCTCCTGAGG No data
1142266863_1142266873 -2 Left 1142266863 16:89067995-89068017 CCAGCAGCCCTGCCCCTAATCTG No data
Right 1142266873 16:89068016-89068038 TGCCTGCCCGGGGGCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142266873 Original CRISPR TGCCTGCCCGGGGGCTCCTG AGG Intergenic