ID: 1142268084

View in Genome Browser
Species Human (GRCh38)
Location 16:89074080-89074102
Sequence GTGACAGGTTCACATGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268084_1142268091 26 Left 1142268084 16:89074080-89074102 CCTGTCACATGTGAACCTGTCAC No data
Right 1142268091 16:89074129-89074151 ACGTGTGGACCTGTCACGTGAGG No data
1142268084_1142268087 -4 Left 1142268084 16:89074080-89074102 CCTGTCACATGTGAACCTGTCAC No data
Right 1142268087 16:89074099-89074121 TCACGAGGACCTGTCACGTGTGG No data
1142268084_1142268089 11 Left 1142268084 16:89074080-89074102 CCTGTCACATGTGAACCTGTCAC No data
Right 1142268089 16:89074114-89074136 ACGTGTGGACCTGTCACGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268084 Original CRISPR GTGACAGGTTCACATGTGAC AGG (reversed) Intergenic
No off target data available for this crispr