ID: 1142268276

View in Genome Browser
Species Human (GRCh38)
Location 16:89075412-89075434
Sequence CCTCCTGGCTGCAGCCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268276_1142268286 27 Left 1142268276 16:89075412-89075434 CCAGTGTGGCTGCAGCCAGGAGG No data
Right 1142268286 16:89075462-89075484 TCGCCACTGACGCTCTTGCTGGG No data
1142268276_1142268285 26 Left 1142268276 16:89075412-89075434 CCAGTGTGGCTGCAGCCAGGAGG No data
Right 1142268285 16:89075461-89075483 CTCGCCACTGACGCTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268276 Original CRISPR CCTCCTGGCTGCAGCCACAC TGG (reversed) Intergenic
No off target data available for this crispr