ID: 1142268281

View in Genome Browser
Species Human (GRCh38)
Location 16:89075444-89075466
Sequence GGCGAGGGCGGTGCTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268281_1142268289 12 Left 1142268281 16:89075444-89075466 CCAGTGAGAGCACCGCCCTCGCC No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data
1142268281_1142268290 20 Left 1142268281 16:89075444-89075466 CCAGTGAGAGCACCGCCCTCGCC No data
Right 1142268290 16:89075487-89075509 CATTGTTGTGCTGGGCCCAGTGG No data
1142268281_1142268286 -5 Left 1142268281 16:89075444-89075466 CCAGTGAGAGCACCGCCCTCGCC No data
Right 1142268286 16:89075462-89075484 TCGCCACTGACGCTCTTGCTGGG No data
1142268281_1142268285 -6 Left 1142268281 16:89075444-89075466 CCAGTGAGAGCACCGCCCTCGCC No data
Right 1142268285 16:89075461-89075483 CTCGCCACTGACGCTCTTGCTGG No data
1142268281_1142268288 11 Left 1142268281 16:89075444-89075466 CCAGTGAGAGCACCGCCCTCGCC No data
Right 1142268288 16:89075478-89075500 TGCTGGGCTCATTGTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268281 Original CRISPR GGCGAGGGCGGTGCTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr