ID: 1142268282

View in Genome Browser
Species Human (GRCh38)
Location 16:89075456-89075478
Sequence AAGAGCGTCAGTGGCGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268282_1142268290 8 Left 1142268282 16:89075456-89075478 CCGCCCTCGCCACTGACGCTCTT No data
Right 1142268290 16:89075487-89075509 CATTGTTGTGCTGGGCCCAGTGG No data
1142268282_1142268291 21 Left 1142268282 16:89075456-89075478 CCGCCCTCGCCACTGACGCTCTT No data
Right 1142268291 16:89075500-89075522 GGCCCAGTGGAGCAAAAGACAGG No data
1142268282_1142268288 -1 Left 1142268282 16:89075456-89075478 CCGCCCTCGCCACTGACGCTCTT No data
Right 1142268288 16:89075478-89075500 TGCTGGGCTCATTGTTGTGCTGG No data
1142268282_1142268289 0 Left 1142268282 16:89075456-89075478 CCGCCCTCGCCACTGACGCTCTT No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268282 Original CRISPR AAGAGCGTCAGTGGCGAGGG CGG (reversed) Intergenic
No off target data available for this crispr