ID: 1142268283

View in Genome Browser
Species Human (GRCh38)
Location 16:89075459-89075481
Sequence AGCAAGAGCGTCAGTGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268283_1142268291 18 Left 1142268283 16:89075459-89075481 CCCTCGCCACTGACGCTCTTGCT No data
Right 1142268291 16:89075500-89075522 GGCCCAGTGGAGCAAAAGACAGG No data
1142268283_1142268295 30 Left 1142268283 16:89075459-89075481 CCCTCGCCACTGACGCTCTTGCT No data
Right 1142268295 16:89075512-89075534 CAAAAGACAGGCCTCCAGCCGGG No data
1142268283_1142268290 5 Left 1142268283 16:89075459-89075481 CCCTCGCCACTGACGCTCTTGCT No data
Right 1142268290 16:89075487-89075509 CATTGTTGTGCTGGGCCCAGTGG No data
1142268283_1142268294 29 Left 1142268283 16:89075459-89075481 CCCTCGCCACTGACGCTCTTGCT No data
Right 1142268294 16:89075511-89075533 GCAAAAGACAGGCCTCCAGCCGG No data
1142268283_1142268289 -3 Left 1142268283 16:89075459-89075481 CCCTCGCCACTGACGCTCTTGCT No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data
1142268283_1142268288 -4 Left 1142268283 16:89075459-89075481 CCCTCGCCACTGACGCTCTTGCT No data
Right 1142268288 16:89075478-89075500 TGCTGGGCTCATTGTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268283 Original CRISPR AGCAAGAGCGTCAGTGGCGA GGG (reversed) Intergenic
No off target data available for this crispr