ID: 1142268284

View in Genome Browser
Species Human (GRCh38)
Location 16:89075460-89075482
Sequence CAGCAAGAGCGTCAGTGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268284_1142268290 4 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268290 16:89075487-89075509 CATTGTTGTGCTGGGCCCAGTGG No data
1142268284_1142268295 29 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268295 16:89075512-89075534 CAAAAGACAGGCCTCCAGCCGGG No data
1142268284_1142268294 28 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268294 16:89075511-89075533 GCAAAAGACAGGCCTCCAGCCGG No data
1142268284_1142268289 -4 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data
1142268284_1142268296 30 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268296 16:89075513-89075535 AAAAGACAGGCCTCCAGCCGGGG No data
1142268284_1142268288 -5 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268288 16:89075478-89075500 TGCTGGGCTCATTGTTGTGCTGG No data
1142268284_1142268291 17 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268291 16:89075500-89075522 GGCCCAGTGGAGCAAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268284 Original CRISPR CAGCAAGAGCGTCAGTGGCG AGG (reversed) Intergenic