ID: 1142268285

View in Genome Browser
Species Human (GRCh38)
Location 16:89075461-89075483
Sequence CTCGCCACTGACGCTCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268280_1142268285 3 Left 1142268280 16:89075435-89075457 CCAAGGAGACCAGTGAGAGCACC No data
Right 1142268285 16:89075461-89075483 CTCGCCACTGACGCTCTTGCTGG No data
1142268281_1142268285 -6 Left 1142268281 16:89075444-89075466 CCAGTGAGAGCACCGCCCTCGCC No data
Right 1142268285 16:89075461-89075483 CTCGCCACTGACGCTCTTGCTGG No data
1142268276_1142268285 26 Left 1142268276 16:89075412-89075434 CCAGTGTGGCTGCAGCCAGGAGG No data
Right 1142268285 16:89075461-89075483 CTCGCCACTGACGCTCTTGCTGG No data
1142268279_1142268285 11 Left 1142268279 16:89075427-89075449 CCAGGAGGCCAAGGAGACCAGTG No data
Right 1142268285 16:89075461-89075483 CTCGCCACTGACGCTCTTGCTGG No data
1142268275_1142268285 27 Left 1142268275 16:89075411-89075433 CCCAGTGTGGCTGCAGCCAGGAG No data
Right 1142268285 16:89075461-89075483 CTCGCCACTGACGCTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268285 Original CRISPR CTCGCCACTGACGCTCTTGC TGG Intergenic
No off target data available for this crispr