ID: 1142268287

View in Genome Browser
Species Human (GRCh38)
Location 16:89075465-89075487
Sequence GAGCCCAGCAAGAGCGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268287_1142268289 -9 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data
1142268287_1142268295 24 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268295 16:89075512-89075534 CAAAAGACAGGCCTCCAGCCGGG No data
1142268287_1142268294 23 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268294 16:89075511-89075533 GCAAAAGACAGGCCTCCAGCCGG No data
1142268287_1142268291 12 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268291 16:89075500-89075522 GGCCCAGTGGAGCAAAAGACAGG No data
1142268287_1142268296 25 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268296 16:89075513-89075535 AAAAGACAGGCCTCCAGCCGGGG No data
1142268287_1142268290 -1 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268290 16:89075487-89075509 CATTGTTGTGCTGGGCCCAGTGG No data
1142268287_1142268288 -10 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268288 16:89075478-89075500 TGCTGGGCTCATTGTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268287 Original CRISPR GAGCCCAGCAAGAGCGTCAG TGG (reversed) Intergenic
No off target data available for this crispr