ID: 1142268289

View in Genome Browser
Species Human (GRCh38)
Location 16:89075479-89075501
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268283_1142268289 -3 Left 1142268283 16:89075459-89075481 CCCTCGCCACTGACGCTCTTGCT No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data
1142268279_1142268289 29 Left 1142268279 16:89075427-89075449 CCAGGAGGCCAAGGAGACCAGTG No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data
1142268287_1142268289 -9 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data
1142268280_1142268289 21 Left 1142268280 16:89075435-89075457 CCAAGGAGACCAGTGAGAGCACC No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data
1142268282_1142268289 0 Left 1142268282 16:89075456-89075478 CCGCCCTCGCCACTGACGCTCTT No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data
1142268281_1142268289 12 Left 1142268281 16:89075444-89075466 CCAGTGAGAGCACCGCCCTCGCC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data
1142268284_1142268289 -4 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268289 16:89075479-89075501 GCTGGGCTCATTGTTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268289 Original CRISPR GCTGGGCTCATTGTTGTGCT GGG Intergenic