ID: 1142268291

View in Genome Browser
Species Human (GRCh38)
Location 16:89075500-89075522
Sequence GGCCCAGTGGAGCAAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268283_1142268291 18 Left 1142268283 16:89075459-89075481 CCCTCGCCACTGACGCTCTTGCT No data
Right 1142268291 16:89075500-89075522 GGCCCAGTGGAGCAAAAGACAGG No data
1142268284_1142268291 17 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268291 16:89075500-89075522 GGCCCAGTGGAGCAAAAGACAGG No data
1142268282_1142268291 21 Left 1142268282 16:89075456-89075478 CCGCCCTCGCCACTGACGCTCTT No data
Right 1142268291 16:89075500-89075522 GGCCCAGTGGAGCAAAAGACAGG No data
1142268287_1142268291 12 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268291 16:89075500-89075522 GGCCCAGTGGAGCAAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268291 Original CRISPR GGCCCAGTGGAGCAAAAGAC AGG Intergenic
No off target data available for this crispr