ID: 1142268294

View in Genome Browser
Species Human (GRCh38)
Location 16:89075511-89075533
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268287_1142268294 23 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268294 16:89075511-89075533 GCAAAAGACAGGCCTCCAGCCGG No data
1142268284_1142268294 28 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268294 16:89075511-89075533 GCAAAAGACAGGCCTCCAGCCGG No data
1142268283_1142268294 29 Left 1142268283 16:89075459-89075481 CCCTCGCCACTGACGCTCTTGCT No data
Right 1142268294 16:89075511-89075533 GCAAAAGACAGGCCTCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268294 Original CRISPR GCAAAAGACAGGCCTCCAGC CGG Intergenic