ID: 1142268296

View in Genome Browser
Species Human (GRCh38)
Location 16:89075513-89075535
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142268284_1142268296 30 Left 1142268284 16:89075460-89075482 CCTCGCCACTGACGCTCTTGCTG No data
Right 1142268296 16:89075513-89075535 AAAAGACAGGCCTCCAGCCGGGG No data
1142268287_1142268296 25 Left 1142268287 16:89075465-89075487 CCACTGACGCTCTTGCTGGGCTC No data
Right 1142268296 16:89075513-89075535 AAAAGACAGGCCTCCAGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142268296 Original CRISPR AAAAGACAGGCCTCCAGCCG GGG Intergenic
No off target data available for this crispr