ID: 1142269157

View in Genome Browser
Species Human (GRCh38)
Location 16:89080134-89080156
Sequence TGGAGAAAGCAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142269152_1142269157 -2 Left 1142269152 16:89080113-89080135 CCTTGTGGGGCTCGGGACTGCTG No data
Right 1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG No data
1142269144_1142269157 28 Left 1142269144 16:89080083-89080105 CCTCAGGCCTGGCGCTGAGTGAT No data
Right 1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG No data
1142269146_1142269157 21 Left 1142269146 16:89080090-89080112 CCTGGCGCTGAGTGATGAGAGGA No data
Right 1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142269157 Original CRISPR TGGAGAAAGCAGAGGGAGGA AGG Intergenic
No off target data available for this crispr