ID: 1142274228

View in Genome Browser
Species Human (GRCh38)
Location 16:89107816-89107838
Sequence ATGCAGCCACATTTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142274228_1142274233 8 Left 1142274228 16:89107816-89107838 CCCAGCCCCAAATGTGGCTGCAT 0: 1
1: 0
2: 6
3: 51
4: 364
Right 1142274233 16:89107847-89107869 CGCCCCCAGCCCCATTCTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142274228 Original CRISPR ATGCAGCCACATTTGGGGCT GGG (reversed) Intronic
900330649 1:2132938-2132960 ATACAGCCACATTGGGGGTTAGG + Intronic
900570738 1:3357106-3357128 ATGCAGCCTTCCTTGGGGCTGGG - Intronic
900822383 1:4899545-4899567 ATACAGTCACATTTGGGGTTTGG + Intergenic
900824029 1:4911949-4911971 ATACAGCCACATGTGGGGTCAGG + Intergenic
902701096 1:18172698-18172720 ATGCAGTCACATTGGGGGTTAGG + Intronic
902722016 1:18310046-18310068 ATGCAGCCACAGGCGGGACTGGG - Intronic
903699656 1:25237363-25237385 TTGCAGTCAGATTAGGGGCTGGG + Intergenic
904820296 1:33238650-33238672 ATCCAGTCACATTGGGGGTTAGG - Intergenic
904885182 1:33732352-33732374 ATGCAGTCACATTGGTGGCTAGG - Intronic
905841759 1:41186616-41186638 ATGTAGTCACATTGGGGGTTAGG - Intronic
905932391 1:41798419-41798441 AAGCAGACAAATTTGAGGCTTGG - Intronic
906222080 1:44088671-44088693 ATGCAGTCACATTGGGGGTTAGG + Intergenic
907093559 1:51752877-51752899 ATATAGCCACCTTTGGGGTTAGG + Intronic
909634667 1:77804130-77804152 ATGCAGCCAGACTTTGTGCTGGG + Intronic
909870054 1:80728069-80728091 ATACAGTCACATTAGGGGTTAGG + Intergenic
910059992 1:83079177-83079199 ATACAGTCACACTGGGGGCTAGG - Intergenic
911401978 1:97386456-97386478 TTGCAGCCACTTTTAAGGCTGGG + Intronic
911979286 1:104545832-104545854 ATACAGTCACATTGGGGGTTAGG - Intergenic
912664560 1:111567544-111567566 ATACAGTTACCTTTGGGGCTAGG - Intronic
913424600 1:118713381-118713403 ATGGTGCCACAGTTGGGGTTTGG - Intergenic
915025092 1:152820565-152820587 ATTCAGTCAAATTTGGGGCCGGG - Intergenic
915316787 1:155033296-155033318 TTGCTGCCATGTTTGGGGCTGGG - Intronic
915444551 1:155967272-155967294 AGGCAGCCAGAATGGGGGCTAGG + Intronic
915475950 1:156152978-156153000 GAGCAGCCACCTTTGGGGGTTGG + Intronic
915814235 1:158949919-158949941 ATGTAGCCACAATTGGGTTTGGG + Intronic
916194601 1:162211486-162211508 ATGCAGTCACATTGGGGTTTAGG + Intronic
917287377 1:173435369-173435391 ATACAGCCACACTGGGGGTTAGG - Intergenic
918586491 1:186194276-186194298 ATGCAGTCACATTGAGGGTTAGG - Intergenic
920090067 1:203446358-203446380 ATACAGCCACATTGGGAGTTAGG - Intergenic
921602136 1:217117354-217117376 AGGCAGCCTCACTTGAGGCTAGG + Intronic
923546644 1:234928177-234928199 ATCCTGCCACCTTGGGGGCTGGG - Intergenic
923748361 1:236724321-236724343 ATACAGGCACATTAGGGTCTAGG + Intronic
1062878865 10:962401-962423 ATGCAGTCACATGGGGGGTTAGG + Intergenic
1062895257 10:1098135-1098157 ATACAGCCACACTGGGGGTTAGG - Intronic
1063056443 10:2509838-2509860 ATACAGCCACATTGGGAGTTAGG + Intergenic
1063208510 10:3857360-3857382 ATACAGTCACATTTGGGGTTAGG - Intergenic
1064878219 10:20019497-20019519 ATACAGTCACACTGGGGGCTAGG - Intronic
1067364522 10:45612750-45612772 ATACAGCCACACTAGGGGTTAGG - Intergenic
1068031272 10:51708351-51708373 ATACAGTCACATTGTGGGCTAGG + Intronic
1070707722 10:78653465-78653487 ATACAGCCACACTGGGGGTTAGG - Intergenic
1070824625 10:79384113-79384135 AGCCAGCCACCTTGGGGGCTGGG - Exonic
1071260096 10:83911966-83911988 ATACAGTCACATTGGGGGTTAGG + Intergenic
1071937354 10:90546749-90546771 ATGCTGCCACTTCTGGGGATGGG - Intergenic
1072121504 10:92409106-92409128 ATACAGTCACATTAGGGGTTAGG + Intergenic
1074442051 10:113486605-113486627 ATGCAGGCAACTGTGGGGCTAGG - Intergenic
1074693207 10:116025615-116025637 ATGCAGCCATATGCGGGCCTAGG + Intergenic
1075702767 10:124479768-124479790 ATGCAGTCACATTGGGGGTTAGG + Intronic
1075921924 10:126220803-126220825 ATGCTGCCAGATTTGTGTCTGGG - Intronic
1076089606 10:127670808-127670830 ATACAGCCACACTGGGGGTTAGG - Intergenic
1076903511 10:133351287-133351309 ATGCAGCCCCAGGTGGGCCTCGG + Intronic
1077408507 11:2393055-2393077 ACACACCCAGATTTGGGGCTCGG - Intronic
1077416512 11:2426598-2426620 AGGAAGCCACATTTGGCTCTTGG - Intergenic
1077715698 11:4577832-4577854 ATACAGGGACTTTTGGGGCTTGG - Intergenic
1079142909 11:17824835-17824857 ATACAGTCACATTGGGGGTTAGG + Intronic
1080890925 11:36408620-36408642 ATGCAGCCACATCAGGGGTGAGG - Intronic
1081188238 11:40071597-40071619 ATGCAGCCACATTCTAGGGTAGG + Intergenic
1081363948 11:42212840-42212862 TTGCTTCCACATTTGAGGCTAGG - Intergenic
1081426454 11:42931375-42931397 ATGCAGTCACATTAGAGGTTAGG - Intergenic
1081565194 11:44256425-44256447 ATGCAGTTACATTGGGGGTTAGG - Intergenic
1082923598 11:58522188-58522210 ATACAGCCACATTGGGGGTTAGG - Intergenic
1083504779 11:63145961-63145983 ATACAACCATATTTGGGGATAGG - Intronic
1084918865 11:72452734-72452756 ATACAGTCACATTGGGGGTTAGG + Intergenic
1085130207 11:74031820-74031842 AGGCAGCAACATTAGGGGCCAGG + Intronic
1085556639 11:77428715-77428737 GAGCATCCACATTTGGGGCAGGG + Intronic
1085598119 11:77829058-77829080 ATACAGTCACATTAGGGGTTAGG - Intronic
1085712684 11:78844239-78844261 ATACAGTCACATTGGGGGTTAGG - Intronic
1086550100 11:88044750-88044772 ACTCAGCCACACTTGGGGTTGGG - Intergenic
1086925394 11:92634794-92634816 ATACAGCCACACTGGGGGCTCGG - Intronic
1087597039 11:100267406-100267428 ATGCAACCACATTAGGGGTTAGG + Intronic
1088350382 11:108880355-108880377 ATACAGCCACATTGGGGGTTAGG + Intronic
1088855802 11:113752362-113752384 ATCTAGTCACATTGGGGGCTAGG - Intronic
1089249851 11:117150577-117150599 ATGCTTTCACGTTTGGGGCTTGG + Intronic
1089320246 11:117621135-117621157 ATGGAGGCAAATTTGGAGCTGGG - Intronic
1090476069 11:127021638-127021660 ATCCAGCCACACTGGGGGTTAGG - Intergenic
1091121366 11:133060602-133060624 ATGCAGCCACAGTAGGAGCAGGG - Intronic
1091496674 12:979092-979114 ATACAGGCACATTGGGGGTTAGG - Intronic
1092991989 12:13911967-13911989 AAGCAGCCACACTCGGGGCCAGG + Intronic
1094123126 12:26994995-26995017 TTGCAGCCACATCTGTGACTTGG - Intronic
1094781303 12:33795195-33795217 CTGCTGGCACATTTGGGGGTGGG - Intergenic
1096464502 12:51840949-51840971 AAGGGGCCATATTTGGGGCTAGG - Intergenic
1098163721 12:67672373-67672395 ATACAGACACATTGGGGGTTAGG - Intergenic
1099787841 12:87289068-87289090 ATACAGTCACATTAGGGGTTAGG - Intergenic
1099977833 12:89564759-89564781 ATACAGTCACATTGGGGGTTAGG + Intergenic
1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG + Intronic
1103533098 12:121616117-121616139 ATGTGACCTCATTTGGGGCTGGG - Intergenic
1103929991 12:124445043-124445065 CTGCTGCCTCATTTGGGGGTCGG - Intronic
1106153865 13:27133834-27133856 ATAAAGCAATATTTGGGGCTGGG + Intronic
1106835447 13:33629471-33629493 ATAGAGCCAAATTTGTGGCTTGG + Intergenic
1107793737 13:44029197-44029219 ATACAGTCACATTTGGTACTTGG - Intergenic
1108165955 13:47693325-47693347 ATGCAGGCAGATTTGGTGGTGGG - Intergenic
1109003997 13:56845793-56845815 TTGCAGTCTCATCTGGGGCTTGG - Intergenic
1109759275 13:66805792-66805814 ATGCAATCACATTTGAGGTTTGG + Intronic
1112248216 13:97753911-97753933 ATGCAGTCACATTGTGGGTTAGG + Intergenic
1113528387 13:111000642-111000664 ATGCAGTCACATTAAGGGTTAGG - Intergenic
1113606732 13:111613240-111613262 ATGCAGCTTCATCTGGGACTGGG - Intronic
1114394248 14:22342529-22342551 ATACAGTCACATTGGGGGCTAGG + Intergenic
1114527054 14:23373052-23373074 AAGCTGCCAGGTTTGGGGCTGGG + Exonic
1115123799 14:29969800-29969822 ATGCTGGCACATTTGGTGCCTGG + Intronic
1116112508 14:40604843-40604865 ATGCAGTCACATTGGAGGTTAGG + Intergenic
1116619588 14:47182332-47182354 ATAAAGCCACATTGGGGGTTAGG - Intronic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1117581338 14:57154393-57154415 ATACAGTCACATTGGGGGATAGG - Intergenic
1118838970 14:69496950-69496972 ATACAGTCACATGTGGGGTTAGG + Intronic
1118940976 14:70337339-70337361 ATACAGACAGATTGGGGGCTAGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120024831 14:79571008-79571030 ATTCAGCCATATTAGGGGTTAGG + Intronic
1120468749 14:84895778-84895800 ATACAGTCACATTGGGGCCTAGG + Intergenic
1120499078 14:85271549-85271571 ATAAAGACACATTTGGGACTTGG + Intergenic
1121720823 14:96107522-96107544 ATACAGCCACACTTGGGGTTAGG - Intergenic
1122160405 14:99780218-99780240 ATACAGTCACATTGGGGGTTGGG + Intronic
1122757003 14:103989660-103989682 ATGGTGCCATATTTGGGACTTGG + Intronic
1124694295 15:31850861-31850883 TTGCAGCCTCATTTTTGGCTTGG - Intronic
1124697746 15:31880111-31880133 ATACCATCACATTTGGGGCTAGG - Intergenic
1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG + Intronic
1125885222 15:43224319-43224341 ATACAGTCACATTGGGGGTTAGG + Intergenic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128885401 15:71282297-71282319 ATGCTGCCTTATTTGGTGCTTGG + Intronic
1129619046 15:77126991-77127013 ATGCAGTAACATTGTGGGCTAGG - Intronic
1129654381 15:77514086-77514108 ATACAGACACATTAGGGGTTAGG + Intergenic
1129942104 15:79507183-79507205 ATATAGCCACATTGGGGGTTAGG + Intergenic
1130518918 15:84647401-84647423 AGGAAGCTCCATTTGGGGCTTGG + Intronic
1131944438 15:97604230-97604252 ATGCAGCCAAAGTTGGGTATGGG + Intergenic
1132841488 16:1980317-1980339 ATGCAGCGGCGTTTGGAGCTGGG - Exonic
1133122054 16:3614953-3614975 ATATAGCCAGATTTGGGGTTGGG - Intronic
1134429999 16:14194471-14194493 ATGCAGTCACATTGGGGGTTAGG + Intronic
1136145450 16:28313747-28313769 ATGGAGCTCCGTTTGGGGCTGGG + Intronic
1137466345 16:48713301-48713323 ATACAGTCACATTGGGGGTTAGG - Intergenic
1138231176 16:55337565-55337587 ATACAGTCACATTAGGGGTTAGG + Intergenic
1138851610 16:60636174-60636196 ATGCATCCACATTTGAGTTTAGG - Intergenic
1139392864 16:66616521-66616543 AGGCAGCCCCCTTTGGGCCTGGG + Exonic
1139652339 16:68368671-68368693 AGGCAGCCAGATGTAGGGCTGGG + Intronic
1140710152 16:77670267-77670289 ATACAGTCACAGTGGGGGCTGGG - Intergenic
1141062335 16:80884909-80884931 ATGCAGTCACATTGAGGGTTGGG + Intergenic
1142274228 16:89107816-89107838 ATGCAGCCACATTTGGGGCTGGG - Intronic
1143320450 17:6065192-6065214 ATGCAGGCAGATCTGAGGCTGGG - Intronic
1143868009 17:9938103-9938125 ATGCAGCCACATTGTGGGTTAGG - Intronic
1144034057 17:11349595-11349617 GAGCAGCCACAGTTGGGGATGGG + Intronic
1144114853 17:12078046-12078068 GTACAGTCACATTTGGGGTTAGG + Intronic
1144495325 17:15741885-15741907 ATGCCTCCACATTTTGGGCGTGG + Intronic
1146724181 17:35144159-35144181 ATACAGCCACATTCAGAGCTAGG - Intergenic
1147462154 17:40580004-40580026 CTGCAGCCATATTGGGGGTTAGG + Intergenic
1149485183 17:57036995-57037017 AGGCAGCCACAGCTGGGTCTGGG + Intergenic
1149557942 17:57587563-57587585 CTGCAGCCACCTTTGGGGCTGGG - Intronic
1149573666 17:57696037-57696059 ATACAGCCACACTGGGGGTTAGG + Intergenic
1149743347 17:59069715-59069737 ATACAGTCACATTGGGGGTTAGG - Intronic
1150074478 17:62180874-62180896 ATACAGCTATATTGGGGGCTAGG - Intergenic
1151200155 17:72462001-72462023 ATGCAGCCTCCCTTGGGGCAGGG - Intergenic
1152792292 17:82287840-82287862 ATGCAGTCACATCGGGGGCTAGG - Intergenic
1154198109 18:12280776-12280798 ATCAAGCCACATGTGGGGGTGGG + Intergenic
1154272591 18:12932876-12932898 AAGCAGCAACAGTTGGGGCAGGG - Intergenic
1155028356 18:21962461-21962483 ATACAGTCACATTGGGGGTTAGG + Intergenic
1155120843 18:22816926-22816948 CTGCAGCCACAATTCGGGCAGGG + Intronic
1155421573 18:25662274-25662296 ATGAGACCAAATTTGGGGCTCGG + Intergenic
1156260877 18:35444188-35444210 ATACAGTCACATTTGGGGTTAGG + Intronic
1157151453 18:45222829-45222851 AAGCAGCCATTTATGGGGCTTGG + Intronic
1157291579 18:46413329-46413351 ATGCAGATAGATTTGGGGATGGG - Intronic
1157348589 18:46863811-46863833 ATACAGTCACATTGGGGGTTAGG - Intronic
1157502037 18:48197806-48197828 ATACAGCCATATTGGGAGCTAGG + Intronic
1158018730 18:52815251-52815273 ATACAGCCACATTGAGGGATAGG - Intronic
1158028610 18:52934657-52934679 ATACAGTCACATTGGGGGTTAGG - Intronic
1158575969 18:58638136-58638158 GTGCAGCCACATTTGCAGATTGG - Intergenic
1159379121 18:67633479-67633501 TTGCAGGCACATTTGTGGTTTGG - Intergenic
1159580600 18:70230872-70230894 ATACAGCCACATTGGGGGTTAGG + Intergenic
1160723419 19:607335-607357 GTCCAGCCACATATGGGACTTGG + Intronic
1161625092 19:5321873-5321895 ATGAAGACAGTTTTGGGGCTTGG - Intronic
1162079726 19:8210678-8210700 AGGCAGACCCATTTGAGGCTGGG - Intronic
1162300862 19:9844143-9844165 ATGCAGCCACACTGGAGGTTAGG + Intronic
1162991807 19:14307779-14307801 ATACAGCCACACTAGGGGTTAGG + Intergenic
1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG + Intergenic
1167613246 19:50517412-50517434 TTCCAGCCCCATCTGGGGCTCGG - Exonic
1167658621 19:50782726-50782748 CTGAACCCACAGTTGGGGCTTGG - Intergenic
1168327382 19:55545198-55545220 ATGCACCCCCACTCGGGGCTGGG - Intronic
925721587 2:6833604-6833626 ATGCAGCCACTCTAGGGGATAGG + Intergenic
926109711 2:10174008-10174030 ATGCAGCCACACTGGGGGTTTGG - Intronic
927365250 2:22287364-22287386 ATACAGTCACATTGGGGGTTAGG + Intergenic
928275446 2:29896378-29896400 ATGCAGTCACATTGGGGATTAGG - Intronic
928702070 2:33909143-33909165 ATCCAGTCACATTAGGGGTTAGG + Intergenic
929217048 2:39425433-39425455 ATGCTGCCACATTGAGGGTTAGG - Intronic
929633235 2:43488126-43488148 ATGCAGTCACCTTTGGAGGTTGG - Intronic
931128014 2:59299036-59299058 ATGCAGTCACAGTGGGGGTTAGG - Intergenic
931382635 2:61767568-61767590 ATACAGTCACATTGGGGGCTGGG + Intergenic
932020317 2:68077943-68077965 ATGCAGTCACATTGAGGGTTAGG + Intronic
932870825 2:75395992-75396014 ATGTTGCCACAATTGGGGATGGG + Intergenic
933261942 2:80140904-80140926 TTGCAGACACATTTGTGCCTGGG - Intronic
934719248 2:96561793-96561815 ATGCAGCCATATTAGGGGTTAGG - Intergenic
935154217 2:100468230-100468252 ATACAGTCACATTGGGGTCTAGG + Intergenic
936371148 2:111903309-111903331 ATGCCCTCACATTCGGGGCTTGG + Intronic
937322025 2:120966655-120966677 TTGCAGCCAAGCTTGGGGCTGGG + Intronic
937445036 2:121950289-121950311 ATAGAGTCACATTTGGGGTTAGG - Intergenic
938100056 2:128492507-128492529 ATGCAGTTATATTGGGGGCTGGG - Intergenic
938389186 2:130891798-130891820 ATGCAGTCACATTGGGTACTGGG + Intronic
938579805 2:132635735-132635757 ATACAGTCAGATTTGGGGTTAGG - Intronic
939944305 2:148390370-148390392 ATGCAGTCACTTTAGGGGTTAGG + Intronic
940778402 2:157907666-157907688 ATGCAGTCACATTGGGGGTTGGG + Intronic
941142510 2:161802924-161802946 ATACAGTCACATTTGGGGTTGGG + Intronic
941516466 2:166486346-166486368 ATGGAGCCAGACTTGGTGCTAGG - Intronic
943098903 2:183462921-183462943 TGACAGCCACATTTGGGGGTGGG - Intergenic
943296183 2:186142794-186142816 ATATAGCCACATTGGGGGTTAGG - Intergenic
943409538 2:187529618-187529640 ATGCAGTCACATTGGGGGTTAGG + Intronic
945636908 2:212366950-212366972 ATACAGTCACATTGGGGGTTAGG - Intronic
946533735 2:220604598-220604620 ATACAGTCACATTGGGGGTTAGG + Intergenic
946667783 2:222068754-222068776 ATACAGCCACATTGGGGATTAGG + Intergenic
946773411 2:223112523-223112545 ATACAGTCACATTGGGGGTTAGG + Intronic
947133729 2:226955868-226955890 ATACAGTCACATTGGGGGTTAGG + Intronic
947579448 2:231304690-231304712 ATGTATCAACATTTGGGGCTGGG - Intronic
947654405 2:231813840-231813862 ATACAGTCACATTGGGGGTTAGG + Intergenic
947950423 2:234142382-234142404 ATACAGTCACATTGGGGGTTAGG - Intergenic
947995420 2:234523310-234523332 ATACAGCCACATTAAGGGTTAGG - Intergenic
948102967 2:235390048-235390070 ATGCAGTCACATCAGGGGTTAGG + Intergenic
948600969 2:239107287-239107309 CTGCAGCCAGATTCGGGGCAGGG + Intronic
948812986 2:240494487-240494509 ATGCTCCCACAGTAGGGGCTAGG - Intronic
949052396 2:241904115-241904137 CTGGAGCCATATCTGGGGCTGGG + Intergenic
1170671658 20:18439917-18439939 ATACAATCACATTGGGGGCTGGG - Intronic
1171322932 20:24262327-24262349 ATGCAGCCACACTGGGGGTGGGG - Intergenic
1171350753 20:24501481-24501503 ATGCAGCCACATAAACGGCTGGG - Intronic
1172298444 20:33830708-33830730 ATGCAGCCACACTGGGGCCAGGG + Intronic
1174820094 20:53719193-53719215 ATACAGTCACATTTGAGGTTAGG - Intergenic
1177794428 21:25758727-25758749 ATGCAGCCACCTTTTGGCATTGG + Intronic
1178205438 21:30458805-30458827 ATACAACCTCATTTGGGGTTGGG + Intergenic
1179357258 21:40672184-40672206 ATACAGTCACATTGGGGGTTAGG + Intronic
1180641405 22:17302373-17302395 ATGCAGTCACATTGAGGGCCAGG - Intergenic
1182543010 22:31055414-31055436 TTTCATCCAAATTTGGGGCTTGG - Intergenic
1183011409 22:34949937-34949959 ATACAGCCTCATTGGGGGTTAGG - Intergenic
1183028686 22:35085652-35085674 ATGCTGCCCCATTTGGGGTGTGG - Exonic
1183112425 22:35660157-35660179 ATACAGCCACATTTTGGTTTAGG - Exonic
1184533706 22:45072331-45072353 ATGAAACGACATTTGGGGCGGGG - Intergenic
1184787793 22:46680217-46680239 TTCCAGCAACACTTGGGGCTTGG + Intergenic
1184798074 22:46743247-46743269 ATGGGGCCACATTTGGAGCCTGG + Intergenic
1185336755 22:50274388-50274410 ATCCAGCCACATTTGAAGCTGGG + Intergenic
952407054 3:33014208-33014230 GTGCAGCCACCTGGGGGGCTGGG - Exonic
952519465 3:34142026-34142048 TTGGAGCTACATTAGGGGCTCGG - Intergenic
952810487 3:37398149-37398171 ATACAGTCACATTGGGAGCTAGG + Intronic
952897370 3:38086624-38086646 ATGCAGTCACATTTGAGCCAGGG - Intronic
953569980 3:44063577-44063599 TTGCAGTCAGATCTGGGGCTGGG + Intergenic
953769329 3:45766585-45766607 ATACAGTCACATTGGGAGCTAGG - Intronic
954273851 3:49529773-49529795 AAGGAGCCACAGATGGGGCTGGG + Intronic
954958999 3:54548269-54548291 ATGTAGCCACATTAGGAGCAAGG + Intronic
955163712 3:56490124-56490146 ATGCAGTCCCATTGGGGGTTAGG - Intergenic
956134071 3:66081840-66081862 CTGCATCCTCATGTGGGGCTTGG - Intergenic
956794896 3:72709032-72709054 ATGCAGTCACATTGGGGGTTAGG - Intergenic
957217715 3:77343172-77343194 ATACAGTCACATTGGGGGTTAGG + Intronic
957410603 3:79834837-79834859 ATACAGCCAGTTTTGGGGTTTGG + Intergenic
957839152 3:85643912-85643934 ATACAGCTACATTGGGGGTTAGG + Intronic
960124785 3:113986651-113986673 ATACAGCCACACTAGGGGTTAGG - Intronic
960463034 3:117960197-117960219 ATGCCGTCACATTTGGGATTAGG - Intergenic
961108201 3:124260315-124260337 GTGCTGCCACATTTGGGCCTGGG - Intronic
961933980 3:130563751-130563773 ATGCAGCCCATTTTGGGGATAGG - Intronic
962853665 3:139326123-139326145 ATACAGCCACATTGGGTGTTAGG - Intronic
963342622 3:144055393-144055415 ATGCATCCATATTTGGGGGCTGG + Intergenic
963877907 3:150497472-150497494 ATACAGTCACATTGGGGGTTAGG - Intergenic
965327881 3:167330487-167330509 ATGTAGTCACATTGGGGGTTAGG - Intronic
966082853 3:176026169-176026191 ATACAGTCACATTGGGGGTTAGG + Intergenic
967641393 3:191868812-191868834 GTACAGCCACCTTCGGGGCTGGG + Intergenic
968442441 4:630730-630752 AGGCAGCCGGAATTGGGGCTTGG - Intronic
968568301 4:1326582-1326604 AGGCAGACACATGTGGGACTTGG + Intronic
969152474 4:5181196-5181218 ATACAGTGACATTGGGGGCTAGG - Intronic
969288585 4:6223751-6223773 ATACAGCCATATTGGGGGTTAGG + Intergenic
969854956 4:9991606-9991628 ATGCAGTCACATTAGGGGTTAGG - Intronic
969872270 4:10111976-10111998 ATGCAGGCAAGTTTGGGGCCTGG - Intronic
970770546 4:19607038-19607060 ATACAGTCACATTGGGGGTTAGG + Intergenic
970882762 4:20950972-20950994 ATACAGCCACACTGGGGGCTAGG - Intronic
971826168 4:31625960-31625982 ATGCAGTCATATTTGGAGTTAGG - Intergenic
972057552 4:34823433-34823455 ATGCAGTCACATTGGAGGTTAGG + Intergenic
972638739 4:40907219-40907241 ATACAGTCACATTGGGGGTTAGG - Intronic
973940532 4:55905536-55905558 ATACAGCCACATGGGGGGTTAGG - Intergenic
974095759 4:57362098-57362120 ATGCAGCCACATTGGAGGTTAGG + Intergenic
977557994 4:98504239-98504261 ATGTCGCCACATCTGGGTCTAGG + Intronic
978199076 4:106004168-106004190 ACACAGTCACATTTGGGGTTAGG - Intergenic
978480577 4:109185627-109185649 ATACAGCCACACTGGGGGTTAGG - Intronic
978926258 4:114249372-114249394 ATGTAGCCACATTTGGTGGGGGG - Intergenic
979322438 4:119340248-119340270 ATGCAGCCACATCCTGGGTTAGG - Intergenic
979480501 4:121210825-121210847 ATGCAGTCACATTGGGGTTTAGG + Intronic
980112029 4:128644942-128644964 ACTCAGCAACACTTGGGGCTGGG + Intergenic
980853842 4:138415337-138415359 ATGCAGCCTCCTTTGGGAGTAGG + Intergenic
981498877 4:145425042-145425064 ATACAGCCACATTGGGGTTTAGG - Intergenic
982228173 4:153184468-153184490 ATACAGCCACATTGGGGGCTAGG + Intronic
982768031 4:159369791-159369813 ATGCAGTCACATTGGGAGTTAGG + Intergenic
983240417 4:165225861-165225883 ATGCAGCCACATCCTGGGTTAGG - Intronic
983550849 4:169015933-169015955 ATACAGCCACATTGGAGGTTAGG - Intergenic
983576223 4:169264391-169264413 ATGTGGCCATATTTGGGGATAGG - Intronic
983596570 4:169474090-169474112 AAGCAGCCACATTAAGGACTTGG + Intronic
985518980 5:362033-362055 ATACAGCCAAACTAGGGGCTAGG - Intronic
986552940 5:8978916-8978938 ATGCAGCCATATAAGGGGCTGGG - Intergenic
986713307 5:10503268-10503290 ATACAGTCACATTGGGGGTTAGG + Intergenic
987154495 5:15075467-15075489 ATGCAGTCATATTTTGTGCTAGG + Intergenic
988329029 5:29810990-29811012 ATACAGACACATTGGGGGTTAGG - Intergenic
989244460 5:39238636-39238658 ATGCAGACACTTTGAGGGCTTGG - Intronic
989302089 5:39907016-39907038 ATGCAGCCATATTTGAAGGTAGG + Intergenic
989526540 5:42459978-42460000 ATTCAGCCACATTGGAGGTTAGG - Intronic
990150437 5:52811486-52811508 AAGCTGCCAGATTTGGGGTTTGG + Intronic
990182219 5:53174045-53174067 ATGCAGTCCCATTGGGGGTTAGG - Intergenic
990460823 5:56029422-56029444 ATACAGCCACACTGGGGGTTAGG - Intergenic
991769409 5:70026558-70026580 TTGAAGCAACATTTTGGGCTGGG + Intronic
991848704 5:70901976-70901998 TTGAAGCAACATTTTGGGCTGGG + Intronic
992066145 5:73111767-73111789 AGGCAGCCAGATTTGGCCCTTGG - Intergenic
992200224 5:74376301-74376323 ATACAGTCACATTGGGGGTTAGG - Intergenic
992744700 5:79807576-79807598 AGGCACCCACATTTGGGGCTGGG + Intergenic
993550384 5:89266514-89266536 ATACAGCCACACTGGGGGTTAGG - Intergenic
995447191 5:112258302-112258324 CTGCAGCTACATTTGGGGTATGG - Intronic
995855763 5:116590488-116590510 ATGCAGCCATACTGGGGGTTAGG - Intergenic
995859638 5:116627964-116627986 AAAGAGCCACATCTGGGGCTGGG + Intergenic
995935951 5:117514114-117514136 ATGAAGCCACATTTAAGACTGGG + Intergenic
996488108 5:124060090-124060112 ATACAGTCACATTGGGGGTTGGG + Intergenic
997394800 5:133550484-133550506 ATTCACCCACAGTTGGGGCTGGG - Intronic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
997650768 5:135517547-135517569 ATACAGCCACATTAGGAGTTAGG - Intergenic
998065568 5:139155587-139155609 ATACAGCCACACTTGGGATTAGG + Intronic
998452338 5:142244666-142244688 ATACAGTCACATTGGGGGTTAGG + Intergenic
998918648 5:147043275-147043297 ATGCAGCCACATTGGGGGTTGGG - Intronic
999130107 5:149275905-149275927 ATACAGTCACACTTGGGGTTAGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999637234 5:153635527-153635549 ACTCAGCCTCATCTGGGGCTAGG - Intronic
1000067124 5:157704181-157704203 ATACAGCCACACTGGGGGTTAGG - Intergenic
1000734722 5:164884909-164884931 GTGCAGAGACATTTGGGGATTGG - Intergenic
1001036406 5:168299895-168299917 CTCCAGCCACATGTGGTGCTAGG + Intronic
1001277809 5:170363322-170363344 ATACAGCCACCTTGGGGGTTAGG - Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1003690597 6:8349992-8350014 ATACAGTCACATTGGAGGCTGGG + Intergenic
1003789094 6:9522344-9522366 ATGCAGCCACATCTGGGACAAGG + Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1007222170 6:40287336-40287358 ATACAGTCACATTGGGGGTTAGG - Intergenic
1007583610 6:42974754-42974776 AAGAAGCCACATTTGCGGCTAGG - Intronic
1007789413 6:44300645-44300667 GTGCAGCCACATGGGGGGCAAGG - Exonic
1007851972 6:44811804-44811826 TTGCAGCCACTTTTGGCACTTGG + Intronic
1010381732 6:75233068-75233090 ATGCAACCATATTTGGAGATAGG + Intergenic
1011079138 6:83470547-83470569 ATGTAACCATATTTGGGGATAGG + Intergenic
1011504738 6:88029028-88029050 ATGCAGCCAAATTTTTTGCTAGG + Intergenic
1012012074 6:93801453-93801475 ATGCAGCCACACTGGGAGTTGGG + Intergenic
1013182349 6:107728822-107728844 ACAGAGCCACATCTGGGGCTTGG - Intronic
1013655152 6:112238963-112238985 ATACAGTCACATTAGGGGTTAGG - Intronic
1013761972 6:113529434-113529456 ATGCAGCCACATTTGGAAGATGG + Intergenic
1014121848 6:117734941-117734963 ATACAGTCACATTTGGGATTAGG + Intergenic
1014253328 6:119137514-119137536 ATACAGTCACATTGGGGGTTAGG + Intronic
1014700676 6:124683806-124683828 ATGCAGAGAGATTTGGGACTTGG + Intronic
1015087253 6:129310400-129310422 ATGCAGCCAGACTTGGATCTAGG + Intronic
1016050720 6:139527395-139527417 ATTCAGCACCCTTTGGGGCTGGG - Intergenic
1016161016 6:140879487-140879509 ATGCAGTCACATTAGGGGTTAGG - Intergenic
1016711669 6:147180406-147180428 AAGTGGCCACATTTAGGGCTGGG + Intergenic
1016736365 6:147484616-147484638 ATACAGCCACACTGGGGGTTTGG + Intergenic
1016760306 6:147729259-147729281 ATAAAGTCACATTTGGGGCTAGG + Intronic
1018383372 6:163280847-163280869 ATACAGCCACACTGGGGGTTAGG + Intronic
1018537386 6:164835965-164835987 ATGCTATCACCTTTGGGGCTAGG + Intergenic
1018926580 6:168211055-168211077 ATGCAGCCACACTGGGGCTTAGG - Intergenic
1019013551 6:168862681-168862703 AAGCTACCACCTTTGGGGCTTGG - Intergenic
1019162082 6:170075657-170075679 ATCCAGCCACATTGGGGGTTAGG + Intergenic
1022091151 7:27108805-27108827 ATGCAGGAACCTTTGGGGCCTGG - Intronic
1022336152 7:29423862-29423884 ATGCAGCTACAAATGGGGCATGG - Intronic
1022992577 7:35722970-35722992 ATACAGCTACATTGGGGGTTAGG + Intergenic
1023362053 7:39426906-39426928 ATGCAGCACCAGTTGGGTCTTGG + Intronic
1023660746 7:42468785-42468807 ATACAGCAAGATTTTGGGCTGGG + Intergenic
1024331412 7:48159254-48159276 ATACAGTCACATTGGGGGTTAGG + Intergenic
1027514642 7:79126353-79126375 ATGCACACTCATTTGAGGCTTGG - Intronic
1028978047 7:96935922-96935944 ATACAGTCACATTTGGGTTTAGG - Intergenic
1029747706 7:102525586-102525608 ATGGAGCCACAGTGGGGGCATGG + Intergenic
1029765657 7:102624676-102624698 ATGGAGCCACAGTGGGGGCATGG + Intronic
1029986532 7:104928050-104928072 ATGTAACCATATTTGGGGATGGG + Intergenic
1030086168 7:105817687-105817709 CTGGAGCAACATTTGAGGCTGGG + Intronic
1030214655 7:107032090-107032112 ATGCGGTCACATTGGGGGTTAGG - Intergenic
1032109253 7:129061286-129061308 ATACAGTCACATTGGGGGCTAGG + Intergenic
1032244369 7:130196558-130196580 AAACAGCCACATTGGGGGTTAGG - Intronic
1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG + Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1032606779 7:133364088-133364110 TTGCAGCCTGATTTAGGGCTGGG + Intronic
1034069105 7:148165361-148165383 ATGCAGTCACATTGGAGGTTAGG + Intronic
1034491224 7:151394139-151394161 ATGCAGCGAGATGAGGGGCTTGG - Intronic
1035568684 8:658587-658609 ATGCAGCCACATCGGGGGCCAGG - Intronic
1037020490 8:13964366-13964388 AAGCACCCAGATTTGTGGCTGGG - Intergenic
1037586475 8:20280144-20280166 ATCCAGCCTCATCTGGGGTTGGG - Intronic
1037737640 8:21580208-21580230 ATACAGTCACATTGGGGGTTAGG - Intergenic
1038485624 8:27933032-27933054 ATACAGTCACATTGGGGGTTAGG + Intronic
1038867724 8:31457998-31458020 ATGTAGCCACACTAGGGGTTAGG - Intergenic
1039460928 8:37743545-37743567 ATACAGTCACATTGGGGGTTAGG + Intronic
1040541600 8:48362065-48362087 ATGCAGCCACACTGGGGGTTAGG + Intergenic
1040551793 8:48443733-48443755 ATGGAGTCAGATTTGGGGTTGGG + Intergenic
1040724730 8:50369194-50369216 ATACAGTCACATTAGGGGTTAGG - Intronic
1041600424 8:59711274-59711296 ATACAACCACATTGGGGGTTAGG - Intergenic
1042653102 8:71065206-71065228 ATGCAGTCACATTGGGGGTTAGG - Intergenic
1043984594 8:86679392-86679414 ATTCAGTCACATTAGGGGTTAGG - Intronic
1044079558 8:87867025-87867047 ATACAGTCACATTGGGGGTTAGG - Intergenic
1045506837 8:102784735-102784757 GGGGAGCCACCTTTGGGGCTGGG - Intergenic
1046304689 8:112349902-112349924 ATACAGTCACATTAGGGGTTAGG - Intronic
1046618515 8:116502730-116502752 AAGAAACCACATGTGGGGCTGGG - Intergenic
1047894066 8:129345399-129345421 ATGCAATCACACTGGGGGCTAGG + Intergenic
1048461503 8:134625319-134625341 ATGCAGGCACATTTGAGGTCTGG - Intronic
1049984048 9:931792-931814 ATACAGTCACATTGGGAGCTAGG + Intronic
1050116100 9:2264924-2264946 ATGCAGCCACCTTCCCGGCTAGG + Intergenic
1051109171 9:13616057-13616079 AAACAGTCACATTTGGGGTTAGG - Intergenic
1051588053 9:18747933-18747955 ATCCAGGCACACTTGAGGCTGGG + Intronic
1051881779 9:21848034-21848056 ATGCTGCCACTTCTGGGGATGGG - Intronic
1053018960 9:34681466-34681488 ATACAGTCACATTTAGGGTTAGG - Intergenic
1053205798 9:36185648-36185670 ATATAGCCACACTTGGGGTTAGG - Intergenic
1053474046 9:38369364-38369386 ATGCAGCCAGGTTTGGGGATGGG - Intergenic
1053535240 9:38919118-38919140 GGGCAGCTACATTTGGGGATTGG - Intergenic
1054207460 9:62143522-62143544 GGGCAGCTACATTTGGGGATTGG - Intergenic
1054630891 9:67444832-67444854 GGGCAGCTACATTTGGGGATTGG + Intergenic
1054833500 9:69651907-69651929 ATGCAGTCACATTGGGGGTTTGG - Intronic
1056219519 9:84437529-84437551 ATGCAAAGGCATTTGGGGCTGGG - Intergenic
1056769133 9:89464382-89464404 AGGCAGCCACAGTTGGGGGTGGG + Intronic
1057171593 9:92966268-92966290 GGGCAGCCACATCTGGGTCTGGG + Intronic
1057320089 9:94004777-94004799 ATACAGTCACATTTGGAGTTAGG + Intergenic
1058383266 9:104403331-104403353 ATACAGCCACATTAGGGGCTAGG + Intergenic
1058719490 9:107750815-107750837 ATGCGGCCAGATTTGGGCCCCGG + Intergenic
1059234417 9:112750424-112750446 CAGCAGCCACGCTTGGGGCTGGG - Intergenic
1061759221 9:132838447-132838469 GTACAGTCACTTTTGGGGCTGGG + Intronic
1185771294 X:2767406-2767428 AAGCAGCCTCATTTTGTGCTGGG - Intronic
1187306149 X:18097026-18097048 ATGCAGTCACATTCGGGGTTAGG + Intergenic
1188287007 X:28339349-28339371 ATACAGTCACATTGGGGGTTAGG + Intergenic
1189545871 X:42042188-42042210 ATACAGTCACATTGGGGGTTAGG + Intergenic
1192251214 X:69415380-69415402 ATACAGTCACATTGGGGGTTAGG + Intergenic
1192594170 X:72388688-72388710 ATGCAGCCACATTAGGGGTTAGG - Intronic
1193988175 X:88273017-88273039 ATGCAACCATATTTGGAGTTTGG - Intergenic
1195508885 X:105691092-105691114 ATGCAGTCACATTGAGGGTTAGG + Intronic
1196049509 X:111290050-111290072 ATGCATCCACACTGAGGGCTTGG - Intergenic
1196187682 X:112762115-112762137 ATGCAGTCACATTGGGAGTTAGG + Intergenic
1196619468 X:117806279-117806301 ATGCAGCCACAGATGGGGGTTGG - Intergenic
1196889443 X:120277937-120277959 ATACAGTCACATTGGGGGATAGG - Intronic
1197731916 X:129818025-129818047 GTGCAGCTACATTGGGGGTTAGG - Intronic
1197893611 X:131288756-131288778 AGGCAGCCAAAGTTGGGGGTGGG - Intronic
1199688549 X:150287423-150287445 ATACAGCCAAATTTGGGGTTAGG - Intergenic
1200292777 X:154887585-154887607 ATGCATCCACGTTTGCGTCTGGG + Exonic
1200339622 X:155383325-155383347 ATGCATCCACGTTTGCGTCTGGG + Intergenic
1200346848 X:155457368-155457390 ATGCATCCACGTTTGCGTCTGGG - Exonic