ID: 1142278670

View in Genome Browser
Species Human (GRCh38)
Location 16:89136720-89136742
Sequence CTGTAGGCACAGAGGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 1, 2: 1, 3: 41, 4: 333}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142278670_1142278681 21 Left 1142278670 16:89136720-89136742 CCCACCTGCCTCTGTGCCTACAG 0: 1
1: 1
2: 1
3: 41
4: 333
Right 1142278681 16:89136764-89136786 CACAGCGGGCTTGTGAGGCCAGG 0: 1
1: 0
2: 0
3: 18
4: 166
1142278670_1142278677 6 Left 1142278670 16:89136720-89136742 CCCACCTGCCTCTGTGCCTACAG 0: 1
1: 1
2: 1
3: 41
4: 333
Right 1142278677 16:89136749-89136771 TCTGCCTCAAGATCACACAGCGG 0: 1
1: 0
2: 2
3: 25
4: 217
1142278670_1142278680 16 Left 1142278670 16:89136720-89136742 CCCACCTGCCTCTGTGCCTACAG 0: 1
1: 1
2: 1
3: 41
4: 333
Right 1142278680 16:89136759-89136781 GATCACACAGCGGGCTTGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 119
1142278670_1142278682 22 Left 1142278670 16:89136720-89136742 CCCACCTGCCTCTGTGCCTACAG 0: 1
1: 1
2: 1
3: 41
4: 333
Right 1142278682 16:89136765-89136787 ACAGCGGGCTTGTGAGGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 160
1142278670_1142278678 7 Left 1142278670 16:89136720-89136742 CCCACCTGCCTCTGTGCCTACAG 0: 1
1: 1
2: 1
3: 41
4: 333
Right 1142278678 16:89136750-89136772 CTGCCTCAAGATCACACAGCGGG 0: 1
1: 2
2: 20
3: 189
4: 936
1142278670_1142278683 23 Left 1142278670 16:89136720-89136742 CCCACCTGCCTCTGTGCCTACAG 0: 1
1: 1
2: 1
3: 41
4: 333
Right 1142278683 16:89136766-89136788 CAGCGGGCTTGTGAGGCCAGGGG 0: 1
1: 0
2: 1
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142278670 Original CRISPR CTGTAGGCACAGAGGCAGGT GGG (reversed) Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900534593 1:3170661-3170683 CTCTGGGCACAGAGGCGGGCTGG - Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
901335251 1:8443727-8443749 ATGTAGTCACAGGGGCATGTGGG - Intronic
902332219 1:15736196-15736218 GTGTGGGCACAGAGGCAGCTGGG + Intergenic
902579768 1:17401122-17401144 CTGACCGCAGAGAGGCAGGTGGG + Intronic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903564084 1:24251426-24251448 GGGTAGGCACAGGGGCAGGGCGG + Intergenic
904061364 1:27713506-27713528 GCTTGGGCACAGAGGCAGGTGGG + Intergenic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
904761971 1:32811835-32811857 CTGCAGGCAAAGATGCAGTTAGG - Intronic
904773281 1:32893001-32893023 CTGGAGGGCCAGAGGCAGCTGGG - Intronic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907563859 1:55416508-55416530 CTGTAGGCTCAGCTGCTGGTGGG - Intergenic
908565739 1:65354374-65354396 CACTAAGCACAGTGGCAGGTGGG - Intronic
909109750 1:71459786-71459808 TTCTAGGCACGGAGGCAGGTAGG - Intronic
909503159 1:76357970-76357992 ATGTTGGCAGGGAGGCAGGTAGG - Intronic
911357305 1:96838225-96838247 CACTAAGCACAGAGGCAGGCTGG + Intergenic
912309971 1:108610341-108610363 ATGTGGGCACAGATGCAGGTAGG + Intronic
912876693 1:113366913-113366935 GGGTAGGCACAGATGTAGGTGGG + Intergenic
912963985 1:114221162-114221184 TTACAGGCACAGATGCAGGTAGG - Intergenic
915145748 1:153795016-153795038 CTGCAGGCAGACAGGCAGATGGG + Intergenic
915148283 1:153808605-153808627 CTGGAGCCAGAGAGGCAGGTGGG + Exonic
915300208 1:154947412-154947434 CTGCAGGCCCAGCTGCAGGTGGG - Exonic
915389274 1:155526726-155526748 CTATAGGAACAGACACAGGTAGG - Intronic
915924380 1:160004865-160004887 CTGTTCGCCAAGAGGCAGGTAGG + Intergenic
915977791 1:160401776-160401798 GTGTAGGTACTGAGGAAGGTGGG + Intronic
916145881 1:161739034-161739056 CTGAAGGTATAGAAGCAGGTGGG + Intergenic
916744422 1:167673792-167673814 TTGTAGGCACAGGGGCTGGCTGG - Intronic
917887683 1:179402449-179402471 ATATAAGCACAGATGCAGGTGGG - Intronic
919816662 1:201445129-201445151 CTGCAGGCAGAAAGGGAGGTAGG + Intergenic
920046937 1:203139319-203139341 CTGTGGGCGCAGATGCTGGTAGG + Intronic
920186236 1:204161159-204161181 CAGTGGGCACAGAGGCAGAGAGG + Intronic
920319607 1:205109021-205109043 CTCTAGGAACAGAGGAAGGCAGG + Intronic
920538410 1:206758038-206758060 CGGTGGGTACAGAAGCAGGTTGG - Intergenic
920607197 1:207400667-207400689 TTTTAGGCATAGAGGCAGTTTGG - Intergenic
921273060 1:213489929-213489951 CTGCAGGCAGAGGGGCTGGTGGG + Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
922918561 1:229279418-229279440 CTACAGGCACAAAGGCAGATGGG - Intronic
923152298 1:231244259-231244281 CTGTAGGAAGAGAATCAGGTTGG + Intronic
923814171 1:237357233-237357255 CTATAGCCAAAGAGGAAGGTAGG - Intronic
924610629 1:245570579-245570601 TTGTGGGCACAGAGGCAGGGAGG + Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1065320676 10:24506184-24506206 CTGCAGGAACAGATCCAGGTGGG + Intronic
1066232456 10:33449568-33449590 ATGTGAGCACAGAGGCAGGCAGG + Intergenic
1067085486 10:43235840-43235862 CTGCAGCCACACAGGCAGGACGG + Intronic
1067342941 10:45419212-45419234 GTGAAGGCGCAGAGGCAGGGAGG + Intronic
1068888604 10:62124818-62124840 GTGTTGGCTCAGAGGTAGGTAGG - Intergenic
1070976251 10:80608281-80608303 CTGAAGGCACAGAGGGCGGGAGG + Intronic
1072552940 10:96493182-96493204 CTGTAGGCACAGAGAGATTTAGG + Intronic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076162301 10:128254620-128254642 CAGCAGGCAGAGAGGGAGGTTGG + Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076721251 10:132394314-132394336 CTGTAGGCACAGCCGCAGCAAGG - Intergenic
1076800709 10:132826746-132826768 CTGGAGCCACAGAGCCAGGCAGG + Intronic
1076867994 10:133178648-133178670 CAGGAGGCACAGAGGCAGCCAGG - Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077239223 11:1501964-1501986 CTGTAGGCACAGAGAGACGGTGG - Intergenic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077797756 11:5509231-5509253 GGGTAGGGACAGAGGCAGCTGGG + Exonic
1078260574 11:9703407-9703429 CTGAAGGCTCTGAGGCAGGAAGG - Intronic
1079281484 11:19090776-19090798 CTGGAAGCATAGAGGCAGATTGG - Intergenic
1080583288 11:33660606-33660628 ATGTAGCAACAGAGGCAGGTGGG - Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1083133975 11:60654402-60654424 CTGTTGACTCAGAGGCATGTAGG - Intergenic
1083609083 11:63996663-63996685 CACTGGGCACCGAGGCAGGTGGG + Intronic
1084911022 11:72389312-72389334 CTGATGGCACAGAGGAAGGTAGG + Intronic
1084916113 11:72430161-72430183 CTGTAGTCACAGAGTCACCTGGG - Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085724365 11:78941550-78941572 CTCTAGGCTCGGAGGCAGGAAGG + Intronic
1087245624 11:95833010-95833032 ATGGGGGCACAGAGGAAGGTGGG + Exonic
1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG + Intergenic
1090797380 11:130146614-130146636 CTGAAAGCAGACAGGCAGGTAGG - Intergenic
1091003686 11:131932783-131932805 CAGGAGGTACAGAGGCTGGTTGG + Intronic
1092945997 12:13454523-13454545 GTGTAGGGGCAGAGGCAGATGGG + Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1100176063 12:92032192-92032214 ATGAAGGCACAGAAGCTGGTTGG + Intronic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1100275818 12:93070937-93070959 CAGTAGAGACAGAGGCAGATGGG + Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101058622 12:100947347-100947369 TTGTGGGCACAGAGGCAGATAGG - Intronic
1101630452 12:106488110-106488132 CTGTGGGCTCAGAAGCAGGCAGG + Intronic
1102884517 12:116511475-116511497 CTGGAGGCAAGGAGGCAGGGAGG - Intergenic
1103020073 12:117526660-117526682 CTGCAGCCACTTAGGCAGGTGGG + Intronic
1104728899 12:131094403-131094425 CTGTGGGCACCGGGGCAGGACGG + Intronic
1104747642 12:131220029-131220051 CTGTAGGCACAGGGGGTGTTTGG + Intergenic
1104845561 12:131845095-131845117 CTGCAGGGAGAGAGCCAGGTGGG - Intronic
1105568135 13:21572357-21572379 ATGTAGGAAGAGGGGCAGGTAGG + Intronic
1105913533 13:24892622-24892644 CGGTAGGCAGGGAGGCGGGTGGG - Exonic
1110136210 13:72070639-72070661 CTGTAGGCAAGCAGGCAGGAAGG + Intergenic
1110965228 13:81686324-81686346 ATGTAGGCACAGAGACAGAAGGG - Intergenic
1112763707 13:102718610-102718632 CTGTGGAAACAGAGCCAGGTTGG + Intergenic
1112828228 13:103417095-103417117 CTGTAGACACCTAGGTAGGTTGG + Intergenic
1113516492 13:110906545-110906567 GGGTAGGCACAGAGGAAAGTGGG - Intronic
1113580686 13:111426501-111426523 CTGAAGTCACAGAGGCAGTGAGG - Intergenic
1113791545 13:113031462-113031484 CTGTAGGGACAGAGTCTGGGAGG + Intronic
1114613487 14:24056549-24056571 CAGGTGGCACAGAGTCAGGTTGG - Intronic
1114638709 14:24204455-24204477 ATGTAGGGACTGAGGCAGGAGGG + Intronic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1115292385 14:31786926-31786948 CTGGAGCCAGAGAGGCTGGTTGG + Intronic
1115762737 14:36591445-36591467 ACGGAGGCACAGAGGGAGGTTGG + Intergenic
1116360585 14:43991605-43991627 CTGTAGTCACAGAGTGTGGTAGG + Intergenic
1117098790 14:52324240-52324262 CAGGAGGCAGAGAGGCAGGAGGG + Intronic
1117847914 14:59932974-59932996 CTGTAGTCAAAGAGATAGGTAGG - Intronic
1120186904 14:81402776-81402798 CTGAAGGCAGGGAGACAGGTAGG - Intronic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121742851 14:96266255-96266277 AAGTAGGCCCAGAGGCAGGTGGG + Intronic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122288882 14:100668846-100668868 CCTGAGGCAGAGAGGCAGGTGGG - Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1124190851 15:27574889-27574911 CTGTGACCACAGAGTCAGGTGGG - Intergenic
1124898198 15:33797215-33797237 CTGTAGGCAGAGAAGAAGGTTGG - Intronic
1125122833 15:36183111-36183133 CTGTAACCAGAGAGGAAGGTAGG + Intergenic
1125225495 15:37390693-37390715 CTGAAGGCAAAGGGGCAGCTAGG + Intergenic
1125522273 15:40354865-40354887 CCATAGGCAGAGAGGCAGGTGGG + Intronic
1128231452 15:66038354-66038376 ATGGAGGCTCAGAGGCAGGCAGG - Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1129297621 15:74608621-74608643 CTGCTGGCCCAGGGGCAGGTGGG - Intronic
1129966828 15:79743450-79743472 CTGTTAGAACAGAGGCAAGTGGG - Intergenic
1130957685 15:88639055-88639077 CTGAGGGCGCAGAGGCAGGCAGG + Exonic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1131133648 15:89916195-89916217 GAGTTGGCACAGAGGGAGGTAGG - Intergenic
1131298522 15:91173576-91173598 TTGAAGGCAAAGAGGCAGGCTGG - Intronic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132502751 16:291860-291882 GTGAAGGCCCAGAGGCAGGTTGG - Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132838957 16:1968948-1968970 CCGCAGGCACAGAGGCAGGCAGG - Exonic
1132877272 16:2145623-2145645 CTGTAGGCCTGGAGGCAGGGAGG - Intronic
1133718196 16:8469515-8469537 CTGGAGGCAGAGAGGCAGGTGGG - Intergenic
1134685763 16:16157043-16157065 CTGTAGGTTCAGAGGGAGGGAGG + Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135224107 16:20640619-20640641 CTGAATGCACAGAGCCAGGGTGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1136547996 16:30966075-30966097 CTATATGCACAGGGGCAGGAGGG + Exonic
1136995874 16:35187821-35187843 CTGGAGCCTCAGAGCCAGGTGGG - Intergenic
1137526318 16:49239517-49239539 TAGTAGGAACAGAGGGAGGTGGG - Intergenic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1138981550 16:62274865-62274887 TTGTAGGCAGAGAGAGAGGTGGG + Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1140489164 16:75319671-75319693 CTGGAGGAAGAGGGGCAGGTTGG - Intronic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1142237334 16:88928387-88928409 GTGTGGCCACAGAGGCAGCTTGG - Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142720910 17:1775203-1775225 CTGTAGGGATAGGGGCAGGGTGG + Intronic
1142797449 17:2319652-2319674 CGGTAGACACAGAAGCAGTTGGG - Intronic
1143284962 17:5782019-5782041 GTGCAGGCACAGATGCAAGTGGG + Intronic
1144083034 17:11781896-11781918 CTGAAGGCACTGAGGCTGGAAGG - Intronic
1145024169 17:19455308-19455330 ATGTAGGAAAAGGGGCAGGTAGG - Intergenic
1146396846 17:32474807-32474829 CGGTATGCAGGGAGGCAGGTAGG + Exonic
1146937869 17:36823877-36823899 CTGTGGGTACAGGGGAAGGTGGG + Intergenic
1148820734 17:50358184-50358206 CTGTAGAGAGAGAGGCAGCTGGG - Intronic
1148866516 17:50631566-50631588 CCGAAGGGAGAGAGGCAGGTTGG - Intergenic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1152236819 17:79143261-79143283 CTGTAAGGACAGAGGCAGGGTGG - Intronic
1152534559 17:80942990-80943012 CTGCACTCACAGAGGCAGGCAGG - Intronic
1153610609 18:6880525-6880547 CTGTAGGCAATGAGGCAGCCTGG - Intronic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1155400594 18:25434876-25434898 CTGTAAGGACAGTGGCAGGCAGG - Intergenic
1156458297 18:37307002-37307024 CTTTAGGCATGGGGGCAGGTGGG + Intronic
1157332264 18:46712542-46712564 CTGCAGGCACAGAGGAGGGAGGG - Intronic
1157564346 18:48669563-48669585 GTTTAGGCAAAGAGGCAGGAGGG - Intronic
1158007206 18:52686323-52686345 CTGTTGGAACAGAGGTAGGCTGG - Intronic
1159923304 18:74246160-74246182 CTGAAGGCACAGAGTCCAGTAGG - Intergenic
1161000646 19:1909176-1909198 CTGTGGGGGCAGATGCAGGTGGG + Intronic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1162899032 19:13783295-13783317 CTGTGGGCACAAAGGCAGGGAGG - Intergenic
1163343931 19:16727692-16727714 ATGGGGGCTCAGAGGCAGGTTGG + Intronic
1163444233 19:17337563-17337585 TTGAAGCCACACAGGCAGGTCGG + Exonic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165443861 19:35845950-35845972 CGGGAGGGACAGAGCCAGGTGGG - Intronic
1165827620 19:38714227-38714249 CTGGAGGCACCGAGGAGGGTTGG - Intronic
1168428055 19:56255457-56255479 CTGTGAGCACTGAGGCAGGTTGG - Intronic
925017698 2:543952-543974 CTGGAGGCAGGGAGGCAGGGAGG + Intergenic
925868579 2:8250045-8250067 CTGTATGCACAAAGGGTGGTAGG + Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
927625103 2:24707871-24707893 CTGGAGGCCCAGAGCCAGGTGGG + Exonic
927914309 2:26925088-26925110 TTGTAGGCAGAGGGGCTGGTTGG + Intronic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
931196406 2:60056012-60056034 CTGTGGGTTCAGATGCAGGTAGG + Intergenic
931212254 2:60208354-60208376 CAGTGGAGACAGAGGCAGGTTGG - Intergenic
934092354 2:88563311-88563333 CTATAAGTACAGAGGCAGGCAGG - Intronic
934714307 2:96534737-96534759 CTGTAGGCACAGAGGCGTCCTGG + Intergenic
935261576 2:101360215-101360237 ATGTAGGAAGAGAGGCAGGTAGG - Intronic
936076669 2:109405732-109405754 CTGTAGGCAAAGAGACAGTGGGG - Intronic
936147159 2:109987598-109987620 CTGTAGTCAGAGAGGCCAGTGGG + Intergenic
936197533 2:110383885-110383907 CTGTAGTCAGAGAGGCCAGTGGG - Intergenic
936584300 2:113740292-113740314 CCGTAGGCAGAAAGGCAGGGAGG + Intronic
937984995 2:127634413-127634435 CTGCTGGGACAGAGGTAGGTGGG + Intronic
938406552 2:131036068-131036090 CTGCAGGCAGAGAGGCAGCCTGG + Intronic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
940333015 2:152495740-152495762 CTGGAGGCAGGCAGGCAGGTAGG - Intronic
944342674 2:198621741-198621763 CTGGAGGCTCAGGGGCAGATGGG - Intergenic
945404806 2:209432294-209432316 CTGTAGGCAGAGAAACAGGAAGG - Intronic
946163799 2:217851677-217851699 GTCTAGGCACAGGGCCAGGTTGG - Intronic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168952808 20:1814126-1814148 CTGGGGGCACAGAGGCGGGCTGG - Intergenic
1169132496 20:3173394-3173416 CAGCAGGCACGGCGGCAGGTCGG + Intronic
1170588950 20:17756583-17756605 CAGTGGGGACAGAGGCAGATTGG + Intergenic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1171163126 20:22946634-22946656 CTGGAGTCACAGAGGCTGGCTGG + Intergenic
1171481387 20:25458222-25458244 CTGTAGGGAGAGAGGCAGTGTGG - Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172197569 20:33102513-33102535 CTGCAGCCACAGAGCCAGGGAGG - Intronic
1172390163 20:34560336-34560358 CTGGAGGCACAGGGCCAGGCAGG - Exonic
1172522872 20:35579508-35579530 AGGTAGCCACAGAGACAGGTAGG + Intergenic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173648056 20:44645999-44646021 CTGTGGGCGCAGAGTGAGGTTGG - Intronic
1174402319 20:50282713-50282735 CAGCAGGGACAGAGACAGGTGGG - Intergenic
1175553730 20:59833079-59833101 CTGTAAGTAGAGAGGCAGGTTGG + Intronic
1176125843 20:63474228-63474250 GCGTGGGCACAGAGGCAGGGAGG - Intergenic
1178375892 21:32067323-32067345 CTGGAAGAACAGAGGCAAGTAGG - Intergenic
1178739596 21:35185957-35185979 CTGCAGTCACAAAGGCAGGATGG - Intronic
1179076150 21:38123585-38123607 ATGGAGGCACAGAGGAAGTTGGG + Intronic
1179359630 21:40693842-40693864 GTCTAGGCTCAGAGGCAGGGTGG + Intronic
1179629053 21:42665579-42665601 CTGTAGGAGCAGAGCAAGGTCGG - Intronic
1180191808 21:46168928-46168950 GTGTGGGCACACAGGCAGGCAGG - Intronic
1181043089 22:20202091-20202113 CAGTAGGTGCAGACGCAGGTGGG - Intergenic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181614094 22:24040154-24040176 CTGGAGGGACAGAGGTAGCTGGG + Intronic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182801598 22:33036112-33036134 ATGTAGGAAGAGGGGCAGGTAGG - Intronic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184533245 22:45070326-45070348 CTGCCAGCACAGAGGCTGGTTGG + Intergenic
1185326446 22:50228029-50228051 CTGTGGGCAAAGAGGCTGGGAGG + Intronic
949931174 3:9079614-9079636 CTGTAGGACCATAGGCAGGTGGG - Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950569303 3:13790366-13790388 CTGTGGGCAGAATGGCAGGTGGG - Intergenic
951514333 3:23541796-23541818 CTATAGGCACATAGTCAGATAGG - Intronic
955200871 3:56851128-56851150 CTGCAGGCACAGAGGAAGTGAGG - Intronic
955467249 3:59250194-59250216 CTGCTGGCACAGAGGAAGGAGGG + Intergenic
956256130 3:67284981-67285003 CTCTAGGGACAGAGTCAGGCTGG + Intergenic
958614237 3:96470818-96470840 CTGTTGACACAGAGGCTAGTAGG - Intergenic
959244141 3:103841921-103841943 CTGAAGGCATATAGGCAGGGAGG - Intergenic
959765099 3:110016916-110016938 GTGTAGGTACAGATGCTGGTAGG - Intergenic
960052278 3:113250385-113250407 CTCTGGGAACAAAGGCAGGTTGG + Intronic
960653685 3:119979439-119979461 CTGAAGGCTTGGAGGCAGGTAGG - Intronic
961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG + Intronic
961640101 3:128359875-128359897 CTGTGAGCACGGAGGCAGCTGGG - Intronic
961693042 3:128684215-128684237 CTGTTGGCAAAGAGGCATCTCGG - Intergenic
964372836 3:156019042-156019064 CCCTAGTCACAGAGGCAGGAAGG + Intergenic
967295699 3:187962707-187962729 ATGTGGGCACAGATGCAGGTGGG + Intergenic
967579016 3:191129871-191129893 CTGTTGGAAGAGAGGCAGGGAGG + Intergenic
968455372 4:695763-695785 CTCCAGGGACAGAGGTAGGTGGG + Intergenic
968935625 4:3608677-3608699 CTGGAGGCACTGGGGCAGGGAGG + Intergenic
969124997 4:4940573-4940595 CAGGAGGCAGAGAGGCAGGTGGG + Intergenic
969253579 4:5987884-5987906 CTGAAAGCACAGAGCCGGGTTGG + Intronic
969312977 4:6364838-6364860 CTGGGGGCAGACAGGCAGGTGGG + Intronic
969530056 4:7725564-7725586 TAGAAGTCACAGAGGCAGGTAGG + Intronic
969998518 4:11340065-11340087 ATGTAGCCACAGAGCCAGGGTGG - Intergenic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
971364269 4:25964988-25965010 CACCAGGCACAGAGGAAGGTGGG - Intergenic
971652051 4:29290310-29290332 AAGTAGGCACAGAGGTAGATAGG + Intergenic
972800880 4:42474568-42474590 CTGAAGGCACAGAGCCAGGCAGG + Intronic
972936740 4:44145699-44145721 CTCTTGGCACATAGGAAGGTAGG - Intergenic
975862211 4:78689796-78689818 ATATGGGCACAGAGGCAGGTAGG - Intergenic
976733075 4:88283930-88283952 CGGTACGCCCAGAGGGAGGTTGG - Intronic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
984926926 4:184815262-184815284 CTGTGAGCAAAGAGGCAGGGAGG + Intronic
986210461 5:5666893-5666915 ATGTAAGAAGAGAGGCAGGTAGG + Intergenic
987088214 5:14488292-14488314 CTGGCGGGACAGAGGCAGGGGGG - Intronic
990221078 5:53589445-53589467 ATGTAGGAAAAGAGGCAGTTAGG + Intronic
991986152 5:72288919-72288941 CTGTAGGAAAAGGGGAAGGTGGG - Intronic
992625735 5:78634476-78634498 CCATAGGCACAGGGGCAGGTGGG - Intronic
993031661 5:82713475-82713497 CTGGAGACAGAGAGCCAGGTTGG + Intergenic
994898576 5:105739675-105739697 CAGGAGGAAAAGAGGCAGGTAGG - Intergenic
995750814 5:115451707-115451729 CTCTGGGCACAGACTCAGGTGGG + Intergenic
995817456 5:116187927-116187949 CTGTAATCACAGAAGCAGTTTGG + Intronic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
998104145 5:139457605-139457627 CTGCAAGGACAGAGGCAGATAGG + Intronic
998744055 5:145236767-145236789 ATGTAGGAAGAGGGGCAGGTGGG - Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1000741653 5:164976094-164976116 CTGTATGCACACTGGAAGGTTGG - Intergenic
1004543462 6:16573777-16573799 TTGTAGGCACAGTGGCAGCAGGG - Intronic
1005071462 6:21866174-21866196 AGATAGGCACAGGGGCAGGTTGG - Intergenic
1006388982 6:33747656-33747678 CCAGAGGCCCAGAGGCAGGTGGG + Intergenic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1007408917 6:41650312-41650334 TTGTAGGCACATCGGCTGGTTGG - Intronic
1007796052 6:44348587-44348609 CTGTGGGCCCAGCAGCAGGTAGG + Intronic
1007830814 6:44637001-44637023 CTGCAGGCACAGAGGATGGCAGG - Intergenic
1007883293 6:45191609-45191631 CTGTAGGGAGGGTGGCAGGTAGG + Intronic
1010639670 6:78308970-78308992 ATGTACATACAGAGGCAGGTAGG - Intergenic
1011057915 6:83226048-83226070 CTGTAGGCACAGGTGAAGATAGG - Intronic
1013296414 6:108761809-108761831 GGGTAGGCACAGATGGAGGTGGG - Intergenic
1013535504 6:111059735-111059757 ATGCAGCCAGAGAGGCAGGTTGG - Intergenic
1013647978 6:112163958-112163980 GTGTGGGCACAGATGCAGGCGGG + Intronic
1014435647 6:121418166-121418188 CTTTGGAGACAGAGGCAGGTGGG + Intergenic
1015666346 6:135634049-135634071 CAATGGGTACAGAGGCAGGTAGG - Intergenic
1015863354 6:137703178-137703200 CTGGAGGCAAGGAGGTAGGTGGG - Intergenic
1017602662 6:156100535-156100557 TCGAAGGCACAGAGGCAGGAAGG - Intergenic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019442221 7:1053153-1053175 CTCTGGGCACAGAGGCAAGCGGG + Intronic
1019464780 7:1181620-1181642 CTGGAGGCAGGCAGGCAGGTAGG + Intergenic
1019866981 7:3721358-3721380 ATGTTGGCACTGGGGCAGGTTGG + Intronic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1022046276 7:26624907-26624929 CTGAACGCACAGACGCAGGGAGG + Intergenic
1022206890 7:28173501-28173523 TTTTAGGCACAAAGGCATGTAGG - Intronic
1022501237 7:30883493-30883515 CTCTGGCCTCAGAGGCAGGTGGG + Intronic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1022948644 7:35314769-35314791 CTGGAGGCAGAGAGCCAGCTAGG + Intergenic
1023590363 7:41774859-41774881 TTCTAGGCATAGAGGCAGATAGG + Intergenic
1023709287 7:42974748-42974770 GCGTGGGCACAGAGGGAGGTTGG + Intergenic
1023967026 7:44968044-44968066 CTATGGGAACAGAGGCAGATGGG - Intronic
1026446832 7:70492103-70492125 CTGCAGGCAGTGAGGCAGGCAGG - Intronic
1029991595 7:104967425-104967447 CAGTAGGGACTGAGGAAGGTTGG + Intergenic
1030524309 7:110635199-110635221 CTGTGGGCACATAGGTAGGATGG - Intergenic
1030605860 7:111638616-111638638 GTGTAGGAAGAGGGGCAGGTAGG - Intergenic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1032489441 7:132313107-132313129 AGGTAGGCAGAGAGGGAGGTTGG - Intronic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1034346714 7:150389737-150389759 CTGGAGACACGGAGGCACGTGGG + Intronic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1035046262 7:155969276-155969298 CAGAAGGCACGGATGCAGGTGGG + Intergenic
1035053396 7:156017666-156017688 CAGGATGCACAGAGCCAGGTGGG + Intergenic
1035053767 7:156020022-156020044 TAACAGGCACAGAGGCAGGTAGG + Intergenic
1035103905 7:156425853-156425875 CTGTTGGAACAGAGGAAGTTTGG - Intergenic
1035531120 8:351558-351580 ATGCAGGTAGAGAGGCAGGTAGG + Intergenic
1035750372 8:1991947-1991969 CGGTAGACACACAGGGAGGTAGG + Intronic
1035777195 8:2197040-2197062 CTGCAGCCACAGAGGCTGGTGGG + Intergenic
1037002795 8:13741072-13741094 CTGTAGGGACAGAGACTGTTGGG - Intergenic
1037902082 8:22694359-22694381 CTGTGGCCACAGAGGCTGCTTGG - Intergenic
1038104204 8:24414964-24414986 CTGTGGGCACAGAGGCCTGTGGG - Intergenic
1039646584 8:39290849-39290871 CTGTAGAAACAGAGACAGTTAGG + Intergenic
1040101526 8:43511171-43511193 CTGTGGGCACACATGCAGGGAGG + Intergenic
1042976745 8:74478344-74478366 ATGCAGGCAAAGTGGCAGGTGGG + Intronic
1043197008 8:77307923-77307945 ATGTAGGTAGAGATGCAGGTTGG + Intergenic
1047380009 8:124352794-124352816 GTGTATCCACACAGGCAGGTTGG + Intronic
1047692538 8:127371122-127371144 CTGCAGGGAGAGTGGCAGGTAGG + Intergenic
1049010006 8:139881039-139881061 TTGTGGGCACAGAGGCATGTTGG - Intronic
1049261558 8:141641746-141641768 CAGGAAGCACAGGGGCAGGTGGG + Intergenic
1049328588 8:142037867-142037889 CAGTAAGGACAGAGGGAGGTGGG - Intergenic
1049811958 8:144579632-144579654 GTGCAGGCACAGAGGGAGGCGGG - Intronic
1053144818 9:35705289-35705311 CTGTAGGCCCAGATGAGGGTCGG + Intronic
1053382632 9:37661233-37661255 CTAGAGTCACAGAGGCAGGAGGG + Intronic
1054454559 9:65423194-65423216 CTGGAGGCACTGGGGCAGGGAGG - Intergenic
1054861088 9:69954252-69954274 CTGTAGGCACATGGGATGGTTGG - Intergenic
1055042283 9:71887567-71887589 TTGTAGCCACAGTGGCTGGTGGG - Intronic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1056841600 9:90002389-90002411 CTGCAAGCACAGAGACAGGCAGG - Intergenic
1056968782 9:91185779-91185801 CTTTAGGCAAAGAAGCAGGAAGG - Intergenic
1057201817 9:93144547-93144569 CTGGAGGGAGAGAGGCAGGGAGG + Intergenic
1057313601 9:93955775-93955797 CGGAGGGCACAGAGGCAGGCGGG + Intergenic
1057446824 9:95122182-95122204 CTGGAGGGAGAGAGGCAGGGAGG + Intronic
1057813750 9:98278908-98278930 GTGTGGGCACTGAGGAAGGTTGG - Intergenic
1058324412 9:103677788-103677810 GTGTAGGCACAGAGGGACGGTGG - Intergenic
1058528864 9:105886365-105886387 CAGGAGACACAGAGGCAGTTGGG - Intergenic
1059445783 9:114337026-114337048 CTGGGGGCCCAGAGGCAGATGGG - Exonic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061362286 9:130151281-130151303 CTGTAGGCAGGCAGGCAGGCAGG + Intergenic
1062190333 9:135244765-135244787 CAGCTGGCAAAGAGGCAGGTGGG + Intergenic
1062345948 9:136115381-136115403 ATGATGGCACAGGGGCAGGTGGG - Exonic
1062399425 9:136365922-136365944 ATGTAGGCACAGAGGCGAGCAGG - Intronic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1185570112 X:1128211-1128233 CTGCAGGGACAGGGACAGGTGGG + Intergenic
1185570171 X:1128499-1128521 CTGCAGGGACAGGGACAGGTGGG + Intergenic
1185663538 X:1745988-1746010 CTGTAGGAGCAGAGACATGTCGG + Intergenic
1187122763 X:16425227-16425249 CTGTATACACTGTGGCAGGTTGG - Intergenic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1189280311 X:39816387-39816409 CTGTGGGCCTAGAGGCAGGCAGG + Intergenic
1190483217 X:50898183-50898205 ATATAGGAAGAGAGGCAGGTAGG + Intergenic
1192547182 X:72023802-72023824 CTGGAGGCAGGGAGGCTGGTGGG + Intergenic
1195631325 X:107058652-107058674 GTGTAGGCACAAAGGTAAGTAGG + Intergenic
1197013304 X:121593621-121593643 ATGAAGGAACAGAGGCAGGGTGG - Intergenic
1199814376 X:151384937-151384959 CAGCTGGCACAGAGGCAGCTAGG - Intergenic
1200910348 Y:8526337-8526359 CTGTAGGGTGAGAAGCAGGTAGG + Intergenic
1201255785 Y:12107062-12107084 CTATAGGCACAGCAGCAGCTTGG + Intergenic