ID: 1142280775

View in Genome Browser
Species Human (GRCh38)
Location 16:89146511-89146533
Sequence AGGTGCCGACGGAGAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142280775_1142280782 5 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280782 16:89146539-89146561 GCCTCTCCCTCTCCTGCCCTGGG 0: 1
1: 1
2: 5
3: 87
4: 833
1142280775_1142280791 20 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280791 16:89146554-89146576 GCCCTGGGGGTGGGTCCTGAAGG 0: 1
1: 0
2: 3
3: 54
4: 473
1142280775_1142280781 4 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280781 16:89146538-89146560 GGCCTCTCCCTCTCCTGCCCTGG 0: 1
1: 1
2: 10
3: 179
4: 3648
1142280775_1142280785 7 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280785 16:89146541-89146563 CTCTCCCTCTCCTGCCCTGGGGG 0: 1
1: 0
2: 7
3: 74
4: 661
1142280775_1142280788 11 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280788 16:89146545-89146567 CCCTCTCCTGCCCTGGGGGTGGG 0: 1
1: 0
2: 9
3: 57
4: 473
1142280775_1142280786 10 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280786 16:89146544-89146566 TCCCTCTCCTGCCCTGGGGGTGG 0: 1
1: 0
2: 8
3: 67
4: 476
1142280775_1142280784 6 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280784 16:89146540-89146562 CCTCTCCCTCTCCTGCCCTGGGG 0: 1
1: 0
2: 8
3: 123
4: 755

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142280775 Original CRISPR AGGTGCCGACGGAGAATGGG TGG (reversed) Intronic
901134695 1:6985289-6985311 AGATGCCCACTGTGAATGGGAGG + Intronic
904619039 1:31764411-31764433 AGGAGCCGCGGGAGAAGGGGCGG + Intronic
906943045 1:50272674-50272696 AGGTGCCCCCAGAGACTGGGAGG + Intergenic
909928990 1:81473127-81473149 AGGTGATGATGGAGAGTGGGTGG + Intronic
910288789 1:85580802-85580824 AGGTCCCGGCGGAGAAGGCGCGG - Exonic
923371665 1:233320494-233320516 AGGTGAGGAAGGAGAAAGGGAGG - Intergenic
923624315 1:235601729-235601751 AGATGCCGACGATGAATGAGTGG + Intronic
1064461060 10:15535214-15535236 AGGAGCCCACGGAGGGTGGGGGG - Intronic
1070172691 10:73944616-73944638 AGGTGTGGAGGGAGAGTGGGAGG + Intergenic
1070895632 10:79981601-79981623 AGGGGAGGACGAAGAATGGGAGG - Intronic
1071900968 10:90119912-90119934 AGGAGCCCACGGAAAATGCGGGG + Intergenic
1074060472 10:109960878-109960900 AGCTGCCCAGGGAGAAGGGGAGG + Intergenic
1076296878 10:129392249-129392271 AGGAGCCGACGGGGAAGGTGAGG - Intergenic
1077037484 11:502461-502483 AGGTGCCCACAGAGGCTGGGTGG - Exonic
1079909813 11:26295826-26295848 AGGTGGGAACGGAGCATGGGAGG - Intergenic
1088481680 11:110301020-110301042 AGGAGCCCACGGAGAAGGCGGGG + Intergenic
1089769055 11:120789618-120789640 AGGTGCCGAGGGACAAGAGGAGG - Intronic
1091287171 11:134413859-134413881 AGGTGCAGAAGCAGGATGGGCGG + Intergenic
1091784258 12:3232790-3232812 AGGTGCCCACTGAGAGTGGCTGG - Intronic
1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG + Intronic
1099528143 12:83741114-83741136 AGGTGCCACTGGAGTATGGGCGG - Intergenic
1113543212 13:111124692-111124714 GGGAGCAGACGGAGGATGGGTGG - Intronic
1114530007 14:23389588-23389610 AGCTGCAGACCGAGAATGGTGGG - Exonic
1114615761 14:24067532-24067554 AGGGGCAGATGCAGAATGGGTGG - Intronic
1117297444 14:54393062-54393084 AGGAGCCCACGGAGAGTAGGGGG + Intergenic
1122690001 14:103527790-103527812 AGGAGCCCACAGAGAGTGGGAGG + Intergenic
1124133380 15:27010241-27010263 AGGTGCCTATGGAGGAGGGGTGG - Intronic
1125979108 15:43983774-43983796 AGGTGGAGACGGTGGATGGGGGG - Intronic
1128960482 15:71998290-71998312 AGGGGGTGACAGAGAATGGGAGG + Intronic
1129948582 15:79563744-79563766 CAGTGCTGACGGAGAAGGGGAGG + Intergenic
1135960612 16:26991703-26991725 AACTGCCGAGGGAGAAGGGGCGG + Intergenic
1138309293 16:56009492-56009514 AGGTCCCCAGGGAGAATGGTGGG + Intergenic
1142280775 16:89146511-89146533 AGGTGCCGACGGAGAATGGGTGG - Intronic
1143483215 17:7238800-7238822 AGTTGCCGCCGGAGAATGCCCGG - Intronic
1150840463 17:68601319-68601341 AGGTGCCAGCGGAGAGTGGGTGG - Exonic
1153665016 18:7360661-7360683 AGGTGTGGAGGGAGAATTGGGGG + Intergenic
1154344085 18:13527962-13527984 AGGAGCCGACAGAGAAATGGAGG - Intronic
1156482481 18:37444991-37445013 AGGTGCAGACAGAGGCTGGGTGG + Intronic
1160856218 19:1219117-1219139 AGGAGCCTACGGGGAAGGGGAGG - Intronic
1160968759 19:1758121-1758143 AGGTGCAGACGGAGAGGGAGGGG + Intronic
1162021728 19:7871138-7871160 AGGTGCCTGAGGAGAGTGGGAGG + Exonic
1165321300 19:35086869-35086891 AGGTGCCAGGGGAGAATGGGTGG - Intergenic
1168680197 19:58309665-58309687 AAGTCCTGATGGAGAATGGGGGG - Intronic
932772528 2:74508344-74508366 AGATGCCGAAGGAGGAGGGGAGG + Exonic
942789614 2:179745117-179745139 GTGTGCCGAATGAGAATGGGAGG - Intronic
944839142 2:203608653-203608675 AGGTGCAGAGGGAGTATGGAGGG - Intergenic
946026391 2:216674206-216674228 AGATGCAAAGGGAGAATGGGTGG + Exonic
1175127158 20:56760906-56760928 AGCTGCCGAAGGAGGAAGGGAGG - Intergenic
1176410206 21:6445691-6445713 AGGTGCCGTGGGAGGCTGGGTGG + Intergenic
1179685699 21:43054013-43054035 AGGTGCCGTGGGAGGCTGGGTGG + Intronic
1180701348 22:17783034-17783056 AGGTGCTGATGGAGAAGCGGGGG + Intergenic
1182508752 22:30803660-30803682 AGGTGCCTACGGAGACTGGAAGG - Intronic
1183604742 22:38861692-38861714 AGGTGCCGCCCCAGCATGGGGGG - Exonic
1183758152 22:39790077-39790099 ATGTGCAGAAGGAGAAGGGGTGG + Intronic
1184457327 22:44618573-44618595 AGGTGCAGAGGGAGAAGGGAGGG + Intergenic
950470196 3:13179994-13180016 AGGAGCCCACGGAGAGGGGGTGG - Intergenic
950744175 3:15073827-15073849 AGGTGCTGACAGAGAATCTGCGG - Exonic
952058056 3:29473586-29473608 AGGAGCCCACGGAGGAGGGGAGG + Intronic
952882600 3:37994195-37994217 AGGTGCGGGTGGAGAAGGGGAGG - Intronic
953963023 3:47281649-47281671 AGGTCCTGAGGGAGAAAGGGAGG - Intronic
955863335 3:63355664-63355686 GGGAGGTGACGGAGAATGGGAGG - Intronic
964296343 3:155238411-155238433 AGGTGGCTACAGAGAAGGGGCGG - Intergenic
970511366 4:16784942-16784964 AGGTGCTGTGGGAGAATGGAGGG - Intronic
978021190 4:103814480-103814502 AGGTGCTGAGAGAGAATGGCAGG + Intergenic
985520645 5:372659-372681 CGGTGCAGACGGAGGGTGGGAGG - Intronic
985773948 5:1830813-1830835 AGGTGGCTACAGAGAGTGGGAGG - Intergenic
985819849 5:2152222-2152244 AGGAGTCCACGGAGACTGGGAGG - Intergenic
1003051839 6:2787528-2787550 AGGCGCCGAGGGAGGATGGAAGG + Intergenic
1005059321 6:21761440-21761462 AGGAGCCCACGGGGAGTGGGGGG - Intergenic
1011260374 6:85464457-85464479 AGGAGCGGACGGAGCCTGGGAGG + Intronic
1015493544 6:133855224-133855246 AGGTGCCGCCAGAGAGTGAGCGG - Intergenic
1016647491 6:146426585-146426607 ATGTGCCGACGGACATTGGCTGG - Intronic
1016954008 6:149608837-149608859 AGGTGCCGACAGAGGCTGGCTGG + Intronic
1017319260 6:153069483-153069505 AGGTGGGGATGGATAATGGGTGG + Intronic
1022363558 7:29685746-29685768 AGGGGAGGACGAAGAATGGGAGG + Intergenic
1028752123 7:94393906-94393928 AGGAGCCCATGGAGAAGGGGAGG + Intergenic
1030917198 7:115329824-115329846 AGGGGCCGATGGAGAAAGGGAGG + Intergenic
1035015815 7:155764794-155764816 AGATGACGAGGGAGAATGAGCGG - Intronic
1035040431 7:155922578-155922600 AGGTGCTTATGGGGAATGGGTGG + Intergenic
1035220353 7:157402688-157402710 AGGGGCCTACGGTGCATGGGTGG + Intronic
1038720645 8:30032526-30032548 AGTTGCAGATGGAGAATTGGTGG - Intergenic
1043857191 8:85276303-85276325 AGGAGCCCACGGAGGTTGGGGGG - Intronic
1061441863 9:130610390-130610412 GGGTGCCCAGGGAGTATGGGTGG + Intronic
1061450303 9:130663970-130663992 AGGAGGGGACGGAGAAGGGGAGG - Intergenic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1195378445 X:104249840-104249862 AGGTGTGGAGGGAAAATGGGTGG + Intergenic
1199134146 X:144231334-144231356 AGGAGCCCATGGAGAAGGGGGGG + Intergenic
1199979116 X:152911406-152911428 AGGTGCTGACTGAGAATTGAAGG + Intergenic