ID: 1142280775

View in Genome Browser
Species Human (GRCh38)
Location 16:89146511-89146533
Sequence AGGTGCCGACGGAGAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142280775_1142280791 20 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280791 16:89146554-89146576 GCCCTGGGGGTGGGTCCTGAAGG 0: 1
1: 0
2: 3
3: 54
4: 473
1142280775_1142280784 6 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280784 16:89146540-89146562 CCTCTCCCTCTCCTGCCCTGGGG 0: 1
1: 0
2: 8
3: 123
4: 755
1142280775_1142280782 5 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280782 16:89146539-89146561 GCCTCTCCCTCTCCTGCCCTGGG 0: 1
1: 1
2: 5
3: 87
4: 833
1142280775_1142280788 11 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280788 16:89146545-89146567 CCCTCTCCTGCCCTGGGGGTGGG 0: 1
1: 0
2: 9
3: 57
4: 473
1142280775_1142280785 7 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280785 16:89146541-89146563 CTCTCCCTCTCCTGCCCTGGGGG 0: 1
1: 0
2: 7
3: 74
4: 661
1142280775_1142280781 4 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280781 16:89146538-89146560 GGCCTCTCCCTCTCCTGCCCTGG 0: 1
1: 1
2: 10
3: 179
4: 3648
1142280775_1142280786 10 Left 1142280775 16:89146511-89146533 CCACCCATTCTCCGTCGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1142280786 16:89146544-89146566 TCCCTCTCCTGCCCTGGGGGTGG 0: 1
1: 0
2: 8
3: 67
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142280775 Original CRISPR AGGTGCCGACGGAGAATGGG TGG (reversed) Intronic