ID: 1142280963

View in Genome Browser
Species Human (GRCh38)
Location 16:89147315-89147337
Sequence CAGAGTGAGCAAGGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1117
Summary {0: 1, 1: 0, 2: 8, 3: 100, 4: 1008}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142280950_1142280963 10 Left 1142280950 16:89147282-89147304 CCACAGTGTGAGTGAGGGAGGAG 0: 1
1: 4
2: 3
3: 55
4: 394
Right 1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG 0: 1
1: 0
2: 8
3: 100
4: 1008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142280963 Original CRISPR CAGAGTGAGCAAGGGGGGGA GGG Intronic
900265823 1:1756720-1756742 CAGCGTGAGCGTGGGGGGGCGGG - Intronic
900700779 1:4047477-4047499 CAGGGAGAGGAAGGGGAGGAAGG + Intergenic
900766996 1:4512434-4512456 CAGAGAGAGAAAGAGGGGGAGGG + Intergenic
900908757 1:5579263-5579285 CAGAATGAGCAAGGGAGCGTGGG - Intergenic
901110320 1:6788173-6788195 AAGAGGGAGAAAGGGAGGGAGGG - Intronic
901330990 1:8408361-8408383 CAAAGAGAGCAAGAGGAGGAGGG + Intronic
901408633 1:9067293-9067315 CAGAGGGATGAAGGTGGGGATGG - Intronic
901472925 1:9470233-9470255 GAGAGGGAGGAAGGGAGGGAGGG + Intergenic
901741948 1:11347605-11347627 AAGAGAGAGAAAGGGAGGGAGGG - Intergenic
901933449 1:12612194-12612216 CAGAGTGAGGATGGGAGAGATGG + Intronic
902097352 1:13957666-13957688 GAGAGAAAGCAAGGTGGGGATGG + Intergenic
902130531 1:14256499-14256521 CAGAGAGAGGAAAGGAGGGAGGG + Intergenic
902185852 1:14724837-14724859 CAGAGTGAGGAAGGGCAGAAGGG - Intronic
903016422 1:20365069-20365091 CACAGCAAGCAAGGGCGGGATGG - Intergenic
903021386 1:20397669-20397691 CCGAGTGAGCAAGCCAGGGAGGG + Intergenic
903296049 1:22343684-22343706 CAGAGTGGGCAAGGGGAAGTGGG + Intergenic
903442329 1:23397447-23397469 GAGAGTGAGGAAGGAGAGGAAGG - Intronic
903946978 1:26970161-26970183 TGCAGTGAGCAAGGGGGAGAGGG + Intergenic
904995411 1:34627702-34627724 CAGAGTGGGGAAGGGGAGGTAGG + Intergenic
905024287 1:34839174-34839196 CAGAGAGAGAGAGGGAGGGAGGG + Intronic
905263000 1:36732329-36732351 CAGAGTGAGCCTGGTGAGGAGGG - Intergenic
905300959 1:36985926-36985948 CACAGTGAGGAGGAGGGGGAGGG - Intronic
905433721 1:37942923-37942945 GAGAGAGAGGAAGGGAGGGAGGG + Intronic
906027109 1:42682864-42682886 GAGAGGGAGTGAGGGGGGGACGG - Intronic
906071906 1:43023011-43023033 CCCAGAGAGCAAGGTGGGGATGG + Intergenic
906491577 1:46272835-46272857 GAGAGTGAGCAAGGGAGGGTAGG + Intronic
907103254 1:51856572-51856594 CAGAGTGAGGTATGGGGGAAGGG + Intronic
907273953 1:53306699-53306721 CAGAGTCTGCAAGGCTGGGAGGG + Intronic
907330076 1:53664978-53665000 CAGAGTGAGCAATGGGGCGAGGG + Intronic
907797976 1:57736743-57736765 AAGAGTGAGAGAGGGAGGGAAGG - Intronic
907802395 1:57783019-57783041 AAGAGCAAGCAAGGGAGGGAGGG - Intronic
908017515 1:59858899-59858921 CAAAGAGAGGGAGGGGGGGAAGG + Intronic
908358351 1:63344074-63344096 GAGAGGGAGGAAGGGAGGGAGGG - Intergenic
908695291 1:66833008-66833030 CAGAGTGGCCAAGGGGGGCAGGG + Intronic
908766096 1:67555728-67555750 CAGCGTGAGGAGGGAGGGGAGGG + Intergenic
908783557 1:67713479-67713501 CAGGGAGAGCAGGGTGGGGATGG + Intronic
909156395 1:72083276-72083298 GAGAATGAGCGAGGGAGGGAGGG - Intronic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
909492374 1:76239540-76239562 GAGAGGGAGCAAGGGGGGAAGGG + Intronic
911162371 1:94694108-94694130 TAGAGTGAACAAGGAGGAGAGGG + Intergenic
911489550 1:98546484-98546506 AAGAGTCAGCAAAAGGGGGAAGG - Intergenic
911591734 1:99755415-99755437 GAGAGAGAGAAAGGGAGGGAGGG + Intronic
912219100 1:107651532-107651554 CAAAGTAAGGAAGGGAGGGAGGG + Intronic
912369786 1:109164947-109164969 GAGAGTGGACAAGGGGGGCAAGG + Intronic
912516638 1:110220469-110220491 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
912703254 1:111894186-111894208 CAGAGTGAACAAGTGGGGTAAGG - Intronic
912738659 1:112173674-112173696 CAGAGTGGGAAAGGGGGTGAGGG - Intergenic
912899148 1:113629770-113629792 GAGAGTGAGGGAGGGAGGGAGGG - Intronic
913257896 1:116972002-116972024 CATGGTGAGCAAGGGCGGGCAGG - Intronic
913349016 1:117837578-117837600 CAGAGTGATCTAGGGGCAGAAGG - Intergenic
914287526 1:146241105-146241127 GAGAGGGAGCAAGAGGGGGGGGG - Intergenic
914724436 1:150315913-150315935 CAGAGGGAGGAAGGGAGGAAGGG - Intergenic
915329832 1:155103985-155104007 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
915553275 1:156647196-156647218 CAGAGGGAGGGAGGGAGGGAGGG + Intronic
915887479 1:159738593-159738615 TAGACTGAGGAAGGGGAGGAAGG - Intergenic
915942749 1:160129222-160129244 CAGTGTCAGCATGGGAGGGAAGG - Intronic
915999504 1:160601184-160601206 CAGAGAGAGGGAGGGAGGGAGGG - Intergenic
916147048 1:161749601-161749623 CAGAGGGAACAAGGGTGGAAAGG + Intergenic
916301873 1:163284791-163284813 CAGAGAGGGGAAGAGGGGGAGGG - Intronic
916563822 1:165955960-165955982 CAGATTGAGCCAGGGCTGGAGGG + Intergenic
916577819 1:166082767-166082789 CAGAGGGAGTAAGATGGGGAAGG + Intronic
916940401 1:169670838-169670860 CTTAGTGAGCAATAGGGGGAGGG + Intronic
917925369 1:179785165-179785187 CAGGGTGAGGAATGGGGGGTGGG - Intronic
918003995 1:180524820-180524842 CAGAGTGAGCAAGTGGGAGAGGG + Intergenic
918110334 1:181450120-181450142 GAGAGAGAGCAAAGGGGGAAGGG + Intronic
918255888 1:182746712-182746734 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
918417570 1:184327899-184327921 CAGAGAGAGAGAGGGAGGGAGGG - Intergenic
918604180 1:186401588-186401610 GAGAGGGAGGAAGGGAGGGAAGG - Intronic
919412654 1:197265434-197265456 CAGAGAGAGAAAGAGGAGGAGGG - Intergenic
919492266 1:198219549-198219571 CAGAATGGGGAAGGGTGGGAGGG + Intronic
919786498 1:201261596-201261618 CACTGTGAGCAAGGGGGTGATGG + Intergenic
919935133 1:202246092-202246114 CAGAGGGAGGGAGGGAGGGATGG - Intronic
920164602 1:204026613-204026635 CAGAGGGAGGAAGGTGGAGAGGG + Intergenic
920211705 1:204333176-204333198 CAGAGTGAGGAAGAAGGGGAAGG + Intronic
920883619 1:209903250-209903272 CAGAGGGAGCAAGAAGGGGAGGG + Intergenic
921985677 1:221309288-221309310 GAGAGTGAGTAAGATGGGGATGG + Intergenic
922507052 1:226132742-226132764 GAGAGTGAGCCAGCTGGGGAAGG + Intergenic
922574930 1:226655108-226655130 AAGAGGGAGGAAGGAGGGGAAGG + Intronic
922812770 1:228427009-228427031 GGGAGTGAGGAAGGGAGGGAAGG - Intergenic
922812799 1:228427105-228427127 GGGAGTGAGGAAGGGAGGGAAGG - Intergenic
923021841 1:230170754-230170776 GAGAGTGAGCAAGAGAGAGAGGG + Intronic
923093488 1:230756984-230757006 GAGAGGGAGGAAGGGAGGGAGGG + Intronic
923148796 1:231216180-231216202 AAGAGAGAGCAAAGGAGGGAAGG - Exonic
923294696 1:232582303-232582325 TAGAGGGAGGAAGGGAGGGAGGG - Intergenic
923445480 1:234066725-234066747 AAGAGAGAGAAAGGGAGGGAGGG - Intronic
923784508 1:237054329-237054351 CAGATGGAGGGAGGGGGGGAGGG - Intronic
923815024 1:237367967-237367989 CAGTCTGATCAAGGGGAGGAGGG + Intronic
924055056 1:240116844-240116866 CAGACTGAGCAAGGAGGGAGAGG + Intronic
924172404 1:241356624-241356646 GAGAGCGAGCAAGGGGAGCAGGG - Intronic
924216356 1:241826397-241826419 CTGAGAGAGCAAGCGAGGGAGGG + Intergenic
924603337 1:245510669-245510691 CAGAGAGAGAGAGGGAGGGAGGG - Intronic
924726305 1:246674448-246674470 CAGAGTGAGGCAGGAGAGGAAGG - Intergenic
924815737 1:247440349-247440371 CTGAGTGAGTAAACGGGGGACGG + Intronic
1062780334 10:199237-199259 GAGAGCGAGCGAGGGGGGAAGGG - Intronic
1063779417 10:9304157-9304179 CAGAGTGAGAAAGGAAGGAAGGG - Intergenic
1064253876 10:13727742-13727764 CAGAGTAAGGAAGAGCGGGAGGG - Intronic
1064865006 10:19869457-19869479 GAGAGAGAGAAAGGGGGGGGGGG + Intronic
1065494983 10:26318563-26318585 AAGAGGGAGAAAGGGAGGGAAGG + Intergenic
1065583301 10:27193080-27193102 GAGAGAGAGGAAGGGAGGGAGGG - Intergenic
1065797615 10:29321776-29321798 CAGAGTGAGCAGGGGTGTGGGGG - Intergenic
1065850128 10:29780902-29780924 GAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1065874352 10:29983922-29983944 GGGAGGGAGCAAGGGAGGGAGGG + Intergenic
1066362568 10:34745410-34745432 GAGAGGGAGGAAGGGAGGGAGGG + Intronic
1067796851 10:49327136-49327158 GAGAGGGAGGAAGGGAGGGAGGG - Exonic
1068329240 10:55539046-55539068 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
1068830652 10:61491167-61491189 GAGAGGGAGGAAGGGAGGGAGGG + Intergenic
1068850358 10:61731758-61731780 CAGAGGGAGGAAGGGAAGGAGGG + Intronic
1069247351 10:66222655-66222677 GAGAGTAAGGAAGGGAGGGATGG + Intronic
1069453406 10:68535189-68535211 GAGAGTGAGCAAGATGGGCATGG - Intergenic
1069851005 10:71404953-71404975 CAGCGAAAGCAAGGGAGGGAGGG + Intronic
1070045751 10:72834550-72834572 CAGAGAGAGAAAGGAGGAGAAGG + Intronic
1070183825 10:74040397-74040419 CACAGAGAGCAAGCGTGGGAGGG - Intronic
1070332586 10:75429074-75429096 CAGAAGGAGGAAGGGGGGAAGGG - Intergenic
1070422285 10:76248806-76248828 CAGAGTGAGCATGTGTGGAAGGG + Intronic
1070508372 10:77137552-77137574 CACAGTGACCAAGCTGGGGATGG - Intronic
1070532036 10:77345474-77345496 CAGAGTGGGCAAGGGAGGCCAGG - Intronic
1070557308 10:77538689-77538711 CAGAGGGACCAAGGTGGGGGAGG - Intronic
1070694041 10:78548623-78548645 GAGAGAGAGGAAGGGAGGGAAGG + Intergenic
1071396151 10:85225967-85225989 CAGAGAGAGCATGGAGGGGGAGG + Intergenic
1071407275 10:85349755-85349777 AAGAGAGAGAAAGGGAGGGAAGG + Intergenic
1071444815 10:85735973-85735995 GAGAGGGAGAAAGGGAGGGAGGG + Intronic
1071514658 10:86289272-86289294 CTGAGTGAGGAAGAGGGGAAGGG + Intronic
1071610510 10:87027334-87027356 CAGAGTCAGCCTGGGGGTGATGG + Intergenic
1071883328 10:89923123-89923145 GAGAGCGAGCAAGGTGGGGGAGG - Intergenic
1071920201 10:90341327-90341349 CAGAGAGAGAGAGGGAGGGAGGG + Intergenic
1072200875 10:93157786-93157808 GAGAAGGAGCAAGGGTGGGAAGG - Intergenic
1072927210 10:99626500-99626522 CAGATTGAGAAAGGGGAGAAAGG - Intergenic
1073451153 10:103610141-103610163 CAGAGTGAGTGAGGGGTGGGAGG + Intronic
1073894920 10:108144334-108144356 CAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1074554903 10:114479464-114479486 CAGAGTTCTCAAGGAGGGGAAGG - Intronic
1075070143 10:119314994-119315016 CTGAGTGGGCAAGGCAGGGAAGG - Intronic
1075282456 10:121151655-121151677 CAGAGTAAACAAGGGGAGAATGG - Intergenic
1075699119 10:124457323-124457345 GAGAGAGAGGAAGGGAGGGAGGG - Intergenic
1076109137 10:127848178-127848200 GAGAGAGAGCAAGGGAGGGAGGG + Intergenic
1076109172 10:127848270-127848292 CAGAGAGAGAGAGGGAGGGAGGG + Intergenic
1076284639 10:129281439-129281461 TACAGAGAGCAAGGTGGGGATGG - Intergenic
1076732137 10:132444289-132444311 GGGAGTGAGCGAGCGGGGGAGGG - Intergenic
1077135416 11:995730-995752 GAGAGGGAGGAAGAGGGGGAGGG - Intronic
1077150009 11:1068456-1068478 CCGAGTGGGGAAGGGTGGGAGGG + Intergenic
1077219015 11:1407211-1407233 CAGAGAGGGCAGGGGTGGGAAGG - Intronic
1077469034 11:2748280-2748302 CAGGGTGAGCTAGGGGGTGGGGG - Intronic
1077478719 11:2803110-2803132 CAGAGTGAGCAAGGGGCTCAGGG + Intronic
1078001747 11:7502251-7502273 CACAGTGAGGAAGGGGAGAAAGG + Intronic
1078458791 11:11497012-11497034 CAGAGTGAGCAAGAGAAGGATGG - Intronic
1078613652 11:12844838-12844860 ATGAGTGAGCAAAGGGGGTAAGG + Intronic
1078807929 11:14725449-14725471 CAGAGGGAGGAAAGGAGGGAGGG - Intronic
1078942377 11:16022377-16022399 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
1078950027 11:16120156-16120178 GAGAGAGAGCAGGAGGGGGAGGG - Intronic
1081593795 11:44445586-44445608 AAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1081664177 11:44906774-44906796 GAGAGTGGGAAAGGAGGGGATGG + Intronic
1082832331 11:57627992-57628014 GAGAGAGAGCAAGGGGAGAAAGG + Intergenic
1083280001 11:61621009-61621031 CAGTGTGACCAAGAGGGGGAGGG - Intergenic
1083332729 11:61906459-61906481 CAGAGAGGGCAAGGAGGTGAGGG - Exonic
1083417605 11:62535777-62535799 CAGAGTGGCCAAGGGAGGGCAGG + Intronic
1083574997 11:63784036-63784058 CAGAGTGAGCCGGGGAGGGGAGG + Intergenic
1083670083 11:64294892-64294914 CAGAGAGAGGGAGGGAGGGAGGG + Intronic
1083962225 11:66020851-66020873 CAGCGTGAGCAAGGTGAAGAGGG + Exonic
1084147383 11:67272258-67272280 CACAGAGGTCAAGGGGGGGATGG + Intronic
1084184244 11:67463305-67463327 CTGAGTGAGCAAGGGTTGGGAGG - Exonic
1084357892 11:68651730-68651752 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1084368662 11:68721556-68721578 CAGAGTGAGCAAGAGAGTTACGG - Intronic
1084495606 11:69501427-69501449 GAGAGGGAGGAAGGGAGGGAGGG + Intergenic
1084579088 11:70011260-70011282 TGGAGTGAGCAGGGGAGGGAAGG + Intergenic
1085079754 11:73624509-73624531 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1085768139 11:79301783-79301805 AAGAGGGAGCAAGGGGGGTGAGG - Intronic
1085806654 11:79643033-79643055 CAGAGGGAGAGAGGGAGGGAGGG + Intergenic
1086212309 11:84335256-84335278 CAGAGGGAGGAAGGGAGGGAGGG + Intronic
1086613037 11:88779923-88779945 CATAGTGAACAAGAGGGAGATGG - Intronic
1086826222 11:91502121-91502143 GAGAGGGAGGAAGGGAGGGAGGG + Intergenic
1087207984 11:95417157-95417179 AGGAGGGAGCAAGGGAGGGAAGG + Intergenic
1087754105 11:102036903-102036925 AAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1087908888 11:103729885-103729907 CAGAGGGAGGAAGGGAGGGAGGG + Intergenic
1087919463 11:103849546-103849568 AAGAGTGGGCTAGGGAGGGATGG + Intergenic
1088689269 11:112311420-112311442 CAGAATGAGCCAGGCGGGGAAGG + Intergenic
1088695288 11:112361160-112361182 CAGAGTTGGGAAGGGTGGGAGGG + Intergenic
1089126264 11:116178633-116178655 CAGAGTGAGGAAGATGGGGAAGG - Intergenic
1089144634 11:116316582-116316604 CAGAGAGAGCGAGGGAGGGAGGG + Intergenic
1089245626 11:117117345-117117367 GAGAGGGAGGAAGGGAGGGAGGG + Intergenic
1089546110 11:119226925-119226947 CATAGTGAACAAGGTGGAGAAGG - Intronic
1089641620 11:119851421-119851443 GAGAGAGAGCAAGGGAGGGAGGG - Intergenic
1089848370 11:121476694-121476716 GAGAGGGAGGAAGGGAGGGAGGG - Intronic
1089983334 11:122790334-122790356 CAGAGTGAGGGAGAGGGGGAGGG - Intronic
1090055730 11:123422850-123422872 CAGAGTGAACACGAGGGAGAAGG - Intergenic
1090232832 11:125121160-125121182 CAAAGTGAGCAAGTGGGAAAAGG + Intergenic
1090342743 11:126039907-126039929 GAGAGCGAGCAAGGGGGCAATGG - Intronic
1090548976 11:127797924-127797946 GAGAGTGAGCAAGGCAGGGTAGG - Intergenic
1091007815 11:131969520-131969542 GAGACTGAGCAAGGGGAGGCAGG + Intronic
1091113805 11:132995453-132995475 CAGAGGGAAGAAGGGAGGGAGGG - Intronic
1092049906 12:5461057-5461079 CAGAGTGGGATTGGGGGGGAAGG + Intronic
1092254911 12:6921555-6921577 CAGAGAGAGCATGGTGGGGAGGG - Intronic
1092598614 12:10034679-10034701 CAGAGTGTGCAATGGAGGTATGG + Intronic
1092761716 12:11816762-11816784 CTGAGTTAGAAAGGGTGGGAGGG + Intronic
1093180586 12:15962741-15962763 GAAAGTAAGCAAGGGGGGGAGGG - Intronic
1094166167 12:27446261-27446283 CAGAGGGAGCAGGAGGGGAAGGG + Intergenic
1094237157 12:28181886-28181908 AAGAGGGAGGAAGTGGGGGAAGG + Intronic
1094405434 12:30110966-30110988 CAGAGTGAGCGAGGGCTGCAAGG + Intergenic
1094827082 12:34277842-34277864 CAGAGTGAGGGAGGAGGAGAAGG - Intergenic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1095658092 12:44695062-44695084 GAGAGGGAGGAAGGGAGGGAGGG + Intronic
1096011700 12:48222699-48222721 AAGAGGGAGGAAGGGAGGGAGGG - Intergenic
1096252413 12:50041493-50041515 GAGAGGGAGAAAGGAGGGGAAGG - Intergenic
1096755749 12:53798025-53798047 CAGAGTGGGCAACCTGGGGAGGG - Intergenic
1097515113 12:60594709-60594731 GAGAGTGAGCAAGGTGGATAAGG + Intergenic
1097995256 12:65881614-65881636 CAGAGGGAGCGAAGGAGGGAGGG + Intronic
1098092858 12:66922728-66922750 CAGAGGGAGAAAAGGGGGAAGGG - Intergenic
1098381662 12:69876650-69876672 TAGAGTGATGAAGGAGGGGATGG + Intronic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1098907180 12:76173946-76173968 CAGATTGTGCAAGTGGAGGAAGG + Intergenic
1099278296 12:80607035-80607057 CAAAGTGAGCAAGGGAAAGAGGG + Intronic
1099946025 12:89245371-89245393 CAAAGTAAGGAAGTGGGGGAAGG - Intergenic
1099996843 12:89787480-89787502 TAGAGTGAGCAAAGGGGGTAGGG - Intergenic
1100172112 12:91986863-91986885 GAGAGAGAGAAAGGGGGGGTGGG - Intronic
1100263059 12:92950658-92950680 AAGAGGGAGGAAGGGAGGGAGGG + Intergenic
1101114801 12:101521696-101521718 CAAAGTGGGCAAGGGAGGGTGGG - Intergenic
1101525312 12:105523220-105523242 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1101830590 12:108253526-108253548 GAGAGAGAGAAAGGGGGGGAAGG - Intergenic
1101878005 12:108608154-108608176 CAGAGTGAGTTAGGGGAGAAGGG + Intergenic
1101925633 12:108969274-108969296 GAGAGTGAGGAAGGGGGAGAAGG - Intronic
1102001642 12:109561257-109561279 CAGAGTGGGCAGGGCTGGGAGGG + Intronic
1102500506 12:113349004-113349026 CAGAGGGAGCAAGGGAAGGAGGG - Intronic
1102544170 12:113642695-113642717 GGGAGGGAGCAAGGGAGGGAGGG - Intergenic
1102907203 12:116685917-116685939 GAGAGGGAGGGAGGGGGGGAGGG + Intergenic
1103927894 12:124433819-124433841 CAGAGAGAGGGAGGGAGGGAAGG - Intronic
1104002420 12:124868707-124868729 CAGAGTGGGCAAGGAGAGGGAGG - Intronic
1104058782 12:125250484-125250506 CAGTGTGAGCAAGAGGGGAAGGG - Intronic
1104065158 12:125299804-125299826 GAGAGTGAACCAGGGTGGGAGGG - Intronic
1104226745 12:126842233-126842255 GAGAGAGAGGAAGGGAGGGAGGG + Intergenic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1104668855 12:130666985-130667007 CAGAGGGAGGAAGGGAAGGAGGG + Intronic
1104668870 12:130667031-130667053 AAGAGGGAGGAAGGGAGGGAGGG + Intronic
1104807583 12:131599310-131599332 CAGAGTGAGAAATGCGGGCAGGG - Intergenic
1104917011 12:132270913-132270935 CAGAGAGAGCAAGGAGGAGATGG + Intronic
1104945687 12:132414047-132414069 CGGAGTCAGCAAGGGTGGGCAGG - Intergenic
1105412694 13:20184641-20184663 CAGGGCGAGAAAGGGGGAGATGG - Intergenic
1105922967 13:24982596-24982618 CGGAGGGAGCAGGGGAGGGAAGG - Intergenic
1106077684 13:26475384-26475406 CTGGGGAAGCAAGGGGGGGAGGG + Intergenic
1106124407 13:26888661-26888683 GAGAGTGAGAAAGGGGGAAAGGG + Intergenic
1106230269 13:27815997-27816019 CAGAGTGAGGGAAGGAGGGAAGG - Intergenic
1106544990 13:30722827-30722849 AAGAGTGAGAGAGGGGTGGAAGG - Intronic
1106891800 13:34253979-34254001 GAGAGAGAGAAAGGGAGGGAAGG + Intergenic
1107186389 13:37526851-37526873 GAGAGAGAGTAAGGGAGGGAGGG - Intergenic
1107287053 13:38805313-38805335 CAGAGGGAGGAAGGAGGAGAGGG + Intronic
1107400730 13:40066475-40066497 CAGAGGGAGGGAGGGAGGGAAGG + Intergenic
1107741682 13:43456761-43456783 CAGTGTGAGCTAGGGAGGGCAGG + Intronic
1108211263 13:48142072-48142094 CAGAGTGAGCAATGTGGGGGTGG + Intergenic
1108420861 13:50248157-50248179 CACAGTGAGCAAGGGGGAAGAGG - Intronic
1108473577 13:50791028-50791050 CCGAGTGGGCGAGGGAGGGAGGG + Intronic
1109218385 13:59616077-59616099 AAGAGGGGGCAAAGGGGGGAAGG + Intergenic
1109470441 13:62797882-62797904 GAGAGCGAGAAAGGGAGGGAAGG + Intergenic
1110103115 13:71634394-71634416 CACAGAGAGCAAGGGGGAGCCGG - Intronic
1110700738 13:78544876-78544898 CAGAGTGAGAAATGGGGTGCAGG + Intergenic
1111452604 13:88438694-88438716 CAGAGGGAGGAAGGGAGGAAGGG + Intergenic
1111468010 13:88643166-88643188 GAGAGTGAGTAAGATGGGGATGG - Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1111691745 13:91572539-91572561 GAGAGTGAGCAAGAGAGGGGAGG + Intronic
1112138136 13:96606593-96606615 CAGAGGGAGGGAGGGAGGGAGGG + Intronic
1112783324 13:102925842-102925864 CAGGGTGGGCAAGGGTGAGAAGG + Intergenic
1113110655 13:106819692-106819714 CAGAGTGAGGAAGGGAGGGGAGG + Intergenic
1113589940 13:111491426-111491448 GAGAGGGAGAAAGGGAGGGAGGG - Intergenic
1113755004 13:112804439-112804461 CAGAGAGGGGATGGGGGGGAGGG - Intronic
1114033132 14:18593835-18593857 GAGAGGGAGAAAGGTGGGGAGGG - Intergenic
1114077925 14:19173032-19173054 GAGAGGGAGCAAGTTGGGGAGGG - Intergenic
1114125811 14:19723930-19723952 GAGAGGGAGCAAGGTGGGGAGGG + Intronic
1114516987 14:23306813-23306835 GAGAGGGAGGAAGGGAGGGAAGG - Exonic
1114523495 14:23352973-23352995 CAGAGAGAGGAAGGGGGGCCAGG + Intergenic
1114756884 14:25269609-25269631 CAGAGTGGGCAGGTGGGGAAGGG - Intergenic
1114856699 14:26455213-26455235 CTGAGTGAGCAATGGGTGAAAGG - Intronic
1115106119 14:29763477-29763499 GAGAGGGAGGAAGGGAGGGAGGG + Intronic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1116903387 14:50382564-50382586 GAGAGGGAGGAAGGGAGGGAGGG - Intronic
1117244809 14:53874256-53874278 GAGAGGGAGAAAGGGAGGGAGGG + Intergenic
1117356496 14:54928731-54928753 CAGAGAGAGAAAGGGATGGAGGG + Intergenic
1118785073 14:69038873-69038895 CACAGTGGGAAAGGGGTGGATGG - Intergenic
1119214860 14:72861164-72861186 CAGAGTGAGCGAGAGAGGGAGGG - Intronic
1119738810 14:77000583-77000605 CAGAGGGAGCCAGGAAGGGAGGG - Intergenic
1120035939 14:79698256-79698278 CAGAAAGGGCAAGGGAGGGAAGG + Intronic
1120433000 14:84443676-84443698 CAGAGAGAGAAAGGGGAGTAGGG + Intergenic
1120627260 14:86843801-86843823 CAAAGTCAGCAATGAGGGGAGGG + Intergenic
1120677931 14:87443491-87443513 GAGAGGGAGGAAGGGAGGGAGGG + Intergenic
1121084944 14:91138648-91138670 GAGAGTGAGCAAGAGGGAGGGGG + Intronic
1121333328 14:93061499-93061521 AGGAGTGAGAAAGGAGGGGAGGG + Intronic
1121668562 14:95691095-95691117 CAGAGTGGGTGAGGGAGGGAGGG + Intronic
1121798382 14:96754116-96754138 CAGGGTGTGGAAGGGGGAGAGGG + Intergenic
1121822555 14:96983152-96983174 CATAGTGTGCAAGAGGGAGATGG - Intergenic
1121843491 14:97154138-97154160 GAGAGTGAGGAAGGGAGGGAGGG - Intergenic
1122322245 14:100862086-100862108 AAGAGGGAGAAAGAGGGGGAGGG - Intergenic
1122364309 14:101185427-101185449 CAGAGTCTGCAAGAGGAGGAAGG + Intergenic
1122541804 14:102502213-102502235 CAGAGGGAGAAAGGGAGAGAAGG + Exonic
1122672336 14:103382265-103382287 AAGAGAGAGGAAGGGAGGGAGGG + Intergenic
1122828331 14:104383164-104383186 CAGTGTGAGCATGTAGGGGAGGG - Intergenic
1123028561 14:105439912-105439934 CAGAGGGGGCAGCGGGGGGAAGG + Intronic
1123449641 15:20351706-20351728 AAGAGAGAGCATGGGGGGGGCGG + Intergenic
1123940702 15:25215267-25215289 GAGGGTGAGCAAGGGTGAGATGG + Intergenic
1123986873 15:25654040-25654062 GAGAGAGAGAAAGGGAGGGAGGG - Intergenic
1124611437 15:31212204-31212226 AAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1125157682 15:36607581-36607603 AAGAGGGAGGAAGGGAGGGAGGG - Intronic
1125539642 15:40462559-40462581 CAAAGTGAGCAGGGAGGGGAGGG - Intronic
1125628886 15:41131698-41131720 GAGAGTCAGCAAAGGGGGGTGGG - Intergenic
1126066073 15:44827423-44827445 CAGAGTGAGCGGGTGGGTGAGGG - Intergenic
1126093762 15:45073141-45073163 CAGAGTGAGCGGGTGGGTGAGGG + Intronic
1126101260 15:45119594-45119616 GAGAGAGAGAAAGGGGGAGAGGG + Intronic
1126181583 15:45790760-45790782 CAGACTGAACAAGGGGCAGATGG - Intergenic
1126639162 15:50807294-50807316 GAGAGAGAGGAAGGGAGGGAGGG - Intergenic
1126690593 15:51286189-51286211 AAGAGAGAGCAAGGGAGAGAAGG - Intronic
1126858571 15:52862164-52862186 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
1127287738 15:57545752-57545774 CTGAGGGAGCAAGGGAGGCAAGG + Intronic
1127311228 15:57753855-57753877 CAGAGTGAGCTGGGGGGGATGGG + Intronic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1127662980 15:61117955-61117977 CAGAGTTATCAAGTGGAGGAGGG - Intronic
1127960445 15:63886664-63886686 GAGAAGGAGCAAGGGGGAGAAGG + Intergenic
1127983381 15:64050428-64050450 CAGAGTGGGCATGGCTGGGAAGG - Intronic
1128211977 15:65909344-65909366 CAGAGGGAGGGAGGGAGGGAAGG - Intronic
1128603202 15:69015277-69015299 CAGAGTGATCTAGGTGGTGAGGG - Intronic
1129181951 15:73883209-73883231 CAGAGTGACCCGGGGTGGGACGG + Intronic
1129270396 15:74416556-74416578 CAGGGTGAGCAGGGGCGTGAGGG - Exonic
1129271938 15:74423583-74423605 CCTAGTGAGCAAGAGAGGGAAGG - Intronic
1129404298 15:75304693-75304715 CAGAGAGAGAAAGGGAGGGAGGG - Intergenic
1129561397 15:76574576-76574598 CAGAATTAGGAAGGGGGAGAAGG + Intronic
1129695277 15:77737441-77737463 GAGAGGGAGGAAGGGGAGGAAGG + Intronic
1129905243 15:79182618-79182640 CAGAAAGAGGAAGGGAGGGAGGG - Intergenic
1129905271 15:79182868-79182890 AAGAGGGAGGAAGGGAGGGAGGG - Intergenic
1129954823 15:79626776-79626798 GAGAGAGAGAAAGGGCGGGAGGG + Intergenic
1130105610 15:80926557-80926579 CAGAGAGAGCAAGAGAGAGAGGG + Intronic
1130130074 15:81133684-81133706 AGGAGGGAGCAAGGGAGGGAGGG + Intronic
1130276013 15:82476698-82476720 CAGAGAGAGGGAGGGGGGGTGGG + Intergenic
1130384808 15:83401759-83401781 CAGAGAGAGCCAGGAGAGGAGGG + Intergenic
1131317385 15:91351929-91351951 GAGTGTGAGCAAGGGGAGGCTGG + Intergenic
1131460044 15:92611288-92611310 GAGAGGGAGGAAGGGAGGGAAGG + Intergenic
1131543581 15:93297069-93297091 CAGAGGCAGCGAGGGGGTGAGGG - Intergenic
1131908093 15:97166071-97166093 CAGAGAGAGGGAGGGAGGGAGGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132021055 15:98363201-98363223 GAGAGAGAGGAAGGGAGGGAGGG + Intergenic
1132033893 15:98463476-98463498 CTGAGTGGGAAAGGGTGGGAAGG + Intronic
1132086189 15:98910192-98910214 TAGAGTGAGCAGGGGGCGGGAGG - Intronic
1133392115 16:5419005-5419027 CAGAGAGAGCAAGGTGGGGAAGG + Intergenic
1133456967 16:5950861-5950883 GAGAGGGAGCTAGGGGGAGATGG + Intergenic
1133589593 16:7229716-7229738 GAGAGGAAGCAAGGGAGGGAGGG + Intronic
1133717027 16:8459595-8459617 CAGAGTTTCCAAGGGGGAGATGG - Intergenic
1133740380 16:8646830-8646852 CAGAGAGACCAAGGGGCGGAGGG - Exonic
1133837663 16:9381084-9381106 CAGAGGAAGCAAGAGAGGGAGGG + Intergenic
1133873782 16:9714027-9714049 CAGACTGAGCAAGGGGGTGGAGG - Intergenic
1134040384 16:11063920-11063942 GAGAGAGAGGAAGGGAGGGAGGG + Intronic
1134108221 16:11499110-11499132 CAAAGAGAGGAAGGGGGGAAGGG + Intronic
1135522596 16:23188962-23188984 CAGAGTGAGCTGGGTGGAGAAGG + Intronic
1135643781 16:24143536-24143558 GAGAGGGAGCTAGGGAGGGAGGG + Intronic
1135850666 16:25960162-25960184 GAGAGTGAGCAAGGGAGAAATGG - Intronic
1135932207 16:26747709-26747731 GAGAGAGAGAAAGGGGGGAAGGG - Intergenic
1136381723 16:29899214-29899236 GAGACTGAGCAAAGGGGGGTGGG - Exonic
1137332620 16:47514215-47514237 CAGAGGGAGGGAGGGAGGGAAGG + Intronic
1137603931 16:49774724-49774746 CAGTCTGGGCAAGGGGAGGAGGG + Intronic
1137825865 16:51494269-51494291 GAGAGAGAGCAAGGAGGGGAGGG - Intergenic
1138453261 16:57106226-57106248 TAGAGTGAGCAATGGGTGGGTGG - Intronic
1138580766 16:57939301-57939323 CTGAGGGGGCAATGGGGGGAAGG + Intronic
1139308195 16:66005952-66005974 CAGAGTGGGTAAGGGGAGGCTGG + Intergenic
1139750125 16:69104828-69104850 CAGACTGAGCAATGGTGGGCAGG + Intergenic
1140535129 16:75702970-75702992 GAGAGTGAGCAAAGGGTGGTGGG + Intronic
1140686478 16:77438315-77438337 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1140939665 16:79709484-79709506 CAGGGTGGGCAACTGGGGGAAGG - Intergenic
1141030392 16:80582640-80582662 CAGAAGGAGGAAGGGTGGGAGGG + Intergenic
1141141632 16:81500309-81500331 CAGAGGGAGGCAGGGAGGGAGGG - Intronic
1141150098 16:81558602-81558624 TGGAGTGAGCAAGGGGCAGAAGG + Intronic
1141225754 16:82113443-82113465 GAGAGAGAGGAAGGGAGGGAGGG - Intergenic
1141527191 16:84618729-84618751 GAGAATGAGGAAGGGGGAGAGGG - Intergenic
1141584897 16:85027560-85027582 CAGAGCCAGCAAGGGGGCGCCGG + Intergenic
1141793291 16:86251167-86251189 GAGAGAGAGCAGGGGAGGGAGGG - Intergenic
1142187471 16:88701359-88701381 CAGAGTGGGCACAGCGGGGATGG + Exonic
1142252650 16:88999715-88999737 CAGAGGGAGGAGGGGGGGGCGGG + Intergenic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1142361121 16:89627580-89627602 GAGAGAGAGGAAGGAGGGGAGGG + Intronic
1142472192 17:170666-170688 CACAGGGAGCAATGGGGTGAGGG + Intronic
1142520088 17:498491-498513 AAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1142526310 17:543985-544007 GAGAGGGAGGAAGGGAGGGAGGG + Intronic
1142615947 17:1135181-1135203 CAGAGTGAGCAGAGGGGGAGAGG + Intronic
1142950013 17:3471164-3471186 GAGAGGGAGGAAGGGAGGGAGGG + Intronic
1143021208 17:3918004-3918026 CGGAGGGAGGAAGGGAGGGAGGG + Intergenic
1143037439 17:4007427-4007449 CAGAGGGAGGAAGAGGGGGTTGG + Intronic
1143701104 17:8660859-8660881 GAGAGAGAGGAAGGGAGGGAGGG - Intergenic
1143780778 17:9228200-9228222 TAGAGGGGGCAAGGGTGGGAAGG + Intronic
1143963447 17:10739075-10739097 CGGAGAGAGGAAGGGAGGGAAGG - Intergenic
1144072670 17:11688742-11688764 CAGAGTGATCAATGGAGGGAGGG + Intronic
1144274563 17:13653310-13653332 GAGAGAGAGAGAGGGGGGGACGG - Intergenic
1144465515 17:15493723-15493745 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
1144670991 17:17132500-17132522 GAGAGGGAGCAGGGTGGGGATGG + Intronic
1144736570 17:17558978-17559000 CAGAGAGAGCAGGGTTGGGATGG - Intronic
1144754604 17:17671524-17671546 CAGACAGAGCAAGAGGGGAAGGG + Intergenic
1144825185 17:18101785-18101807 CTGAGGCAGCAAGGGGAGGAAGG + Intronic
1144847973 17:18229924-18229946 CACAGTCTGCAAGGAGGGGAGGG - Exonic
1145143278 17:20461397-20461419 CAGAGAGACCAAGGTGGGGGTGG - Intronic
1145769190 17:27480125-27480147 CAGGATGAGCAATGGGGTGAAGG - Intronic
1145898694 17:28475790-28475812 CAGAGTCAGGAAAGGTGGGAAGG - Intronic
1145938308 17:28727536-28727558 CAGAGTGGGCAAGGGGTGTGAGG - Intronic
1146488406 17:33262317-33262339 GAGAGGGAGAAAGGGAGGGAGGG + Intronic
1147387421 17:40090600-40090622 CAGAGTGCTAAAGGGGTGGAGGG - Intronic
1147632740 17:41942645-41942667 CAGGGTCAGCAAGGTGGGCAAGG + Intronic
1147738942 17:42659549-42659571 CAGAGTGAGCAAGCGAGCGCCGG + Exonic
1147755957 17:42768014-42768036 GAGAGTTAGAAATGGGGGGATGG + Intergenic
1147757037 17:42775561-42775583 CAGACTGAGCAAAATGGGGAGGG + Intronic
1147917532 17:43897710-43897732 AAGAATGAGGAAGAGGGGGAGGG - Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148959955 17:51384841-51384863 CAGAGTCCGCAACGGAGGGAGGG - Intergenic
1149283713 17:55137279-55137301 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
1149544446 17:57492984-57493006 CAGAGTGAGCCAGCGTAGGATGG + Intronic
1150424771 17:65068583-65068605 GAGAGAGAGGAAGGGAGGGAGGG - Intergenic
1150478084 17:65488993-65489015 GAGAGGGAGCGAGGGAGGGAAGG + Intergenic
1150747832 17:67830615-67830637 CAGATTGAGGGAGGGAGGGAGGG + Intronic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151078503 17:71301543-71301565 GAGAGAGAGAAAGGGAGGGAGGG - Intergenic
1151133436 17:71922260-71922282 CTGAGTGAGCAAAGGAGTGAGGG + Intergenic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151478078 17:74354944-74354966 CAGTATGGGCAAGGAGGGGATGG + Intronic
1151576806 17:74956590-74956612 GAGAGTGAACCAGGAGGGGAAGG + Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152001192 17:77646187-77646209 CCGAGTGGGCACGGTGGGGAGGG + Intergenic
1152038115 17:77885581-77885603 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1152257864 17:79250801-79250823 GAGAGAGAGAAAGGGAGGGAGGG - Intronic
1152677892 17:81651027-81651049 CACAGTGGGCAGGAGGGGGAGGG + Exonic
1153285210 18:3450155-3450177 CAGAGTGAGAGAGGCGAGGAGGG - Intronic
1153299885 18:3583220-3583242 CAGAGAGAGAAAGGGAGGGAGGG - Intronic
1153588787 18:6651408-6651430 GAGAGTGAGGAAGGGAAGGAGGG - Intergenic
1154078191 18:11225810-11225832 GAGTGTGAGCAGGTGGGGGAAGG - Intergenic
1154338980 18:13487899-13487921 CACTGAGAGCAAGGGGGAGATGG + Intronic
1154979371 18:21489913-21489935 CAGATTAAGCATGGTGGGGAAGG - Intronic
1155140474 18:23039992-23040014 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1155829195 18:30491868-30491890 AAGAGTGAGGGAGGGAGGGAAGG + Intergenic
1155976703 18:32139708-32139730 CAGAGCGAGCAAGGGCTGTAAGG - Intronic
1156463571 18:37334996-37335018 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
1157293176 18:46424342-46424364 GAGAGAGAGCAAGGCTGGGAGGG + Intronic
1157470117 18:47982510-47982532 AAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1157563787 18:48666185-48666207 AAGAGTGAGCAGGGGAGGGCTGG - Intronic
1157652064 18:49343282-49343304 CAGAATGAGCAAGGATGGGGAGG - Intronic
1157811876 18:50703168-50703190 GGGAGTGAGCATGGGGAGGAGGG - Intronic
1158185415 18:54765821-54765843 CACAGTGAGCAATGGGGTGTGGG - Intronic
1158343795 18:56494184-56494206 CACAGTGAGCAAAGAGGGGTGGG - Intergenic
1158346183 18:56519237-56519259 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1158735248 18:60072340-60072362 GAGAGAGAGCAAGGGGGTGTGGG + Intergenic
1159670294 18:71212995-71213017 CAGAGCGAGCGAGGGCTGGAGGG + Intergenic
1159804101 18:72934500-72934522 GAGAGAGAGCAAAGGAGGGAGGG - Intergenic
1159939698 18:74397425-74397447 CAGAGTGAGCGAGAGCGAGAGGG + Intergenic
1160965268 19:1744608-1744630 GAGGGTGAGAAAGGGGAGGAAGG - Intergenic
1161088489 19:2345755-2345777 GAGAATGAGAAAGAGGGGGACGG - Intronic
1161103973 19:2434244-2434266 CAGAGTGAGGAGGAGGGGCAGGG - Intronic
1161142977 19:2659730-2659752 GAGTGTGAGCGAGGGAGGGATGG + Intronic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161274907 19:3410518-3410540 CAGAGTGAGGAAGGGGAGACAGG + Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161435737 19:4261862-4261884 CTCAGTGAGCAGGGGTGGGAGGG - Intronic
1161496733 19:4590697-4590719 CAGAGTGAGGAATGGGAGGAAGG + Intergenic
1161507304 19:4650773-4650795 CCGAGTGAGCCAGGGGGTGATGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161634220 19:5377179-5377201 CAGAGTGAGGAAGGGGAGAGAGG + Intergenic
1161636223 19:5390905-5390927 CAGAGTGAGTAATGGGGAGATGG - Intergenic
1161719750 19:5896227-5896249 CAGAGTGAGGAGGGGAGGGTGGG + Intronic
1161754237 19:6119833-6119855 GAGAGAGAGAAAGGGGTGGAAGG - Intronic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1162343352 19:10105663-10105685 CAGAGAGAGCAAGGAGGGAGAGG + Intergenic
1162400726 19:10445022-10445044 CAGAATGAGTGAGGGGGGAAGGG + Intronic
1162457057 19:10791703-10791725 CAGACTGGGCGACGGGGGGAGGG - Intronic
1162735714 19:12745858-12745880 CAGAGTGAGAAGGGGTGGGAAGG - Intronic
1162937575 19:13989044-13989066 GAGAGTGAGCAATGGGGGTAGGG + Intronic
1162998986 19:14354126-14354148 GAGAGTGAGCAAGGGAGGGAGGG + Intergenic
1163373561 19:16915987-16916009 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
1163396463 19:17065933-17065955 TAGAGTGAGATATGGGGGGAAGG - Intronic
1163407798 19:17134216-17134238 CATAGTGGGAAAGGGGAGGAAGG - Intronic
1163421213 19:17214673-17214695 GAGAGTGAGCAAGGTGGGGCTGG - Intergenic
1163567200 19:18058733-18058755 CAGGGTGTGTAAGGGGGGCAAGG + Intergenic
1163673674 19:18644599-18644621 GAGAGGGAGGAAGGGAGGGATGG + Intronic
1163776977 19:19224618-19224640 CAGAGAGAGGAAGGGGGCAAAGG - Intronic
1163884094 19:19950707-19950729 CAGAGTGAGATATGGGAGGAAGG - Intergenic
1164536077 19:29087483-29087505 CGGAGTGAGGAGGGGTGGGAAGG - Intergenic
1165075368 19:33277364-33277386 CGCAGTGAGCAAGGGTGGCAGGG + Intergenic
1165119426 19:33549527-33549549 GTGAGTGAGCAACTGGGGGATGG - Intergenic
1165650391 19:37482865-37482887 GAGAGGGAGAAAGGGGGGGAGGG - Intronic
1165891884 19:39117547-39117569 AAGATTGAGCAAGGGGGACATGG + Intergenic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1165991408 19:39816762-39816784 TAAAGAAAGCAAGGGGGGGATGG + Intergenic
1166007316 19:39916481-39916503 CAGAGTGAGCCCGAGGGAGAGGG - Intronic
1166135625 19:40775504-40775526 GAGAGTGAGCAAGGGGGTGCTGG - Exonic
1166275104 19:41748062-41748084 GAGAGAGAGGAAGGGAGGGAAGG + Intronic
1166305207 19:41933480-41933502 CAGAGAGGGAAAGAGGGGGAGGG + Intergenic
1166317542 19:41997557-41997579 CAGAGTGGGCGGGAGGGGGATGG - Intergenic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166551055 19:43666519-43666541 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
1166567900 19:43776308-43776330 GTGAGTGTGCAAGGGGGGGCTGG + Intronic
1166645788 19:44530715-44530737 CAGAGTGGGCAGGGCTGGGATGG + Intergenic
1166648078 19:44547571-44547593 CAGAGGAAGGAAGGGAGGGAGGG + Intergenic
1166658020 19:44626504-44626526 CAGAGTGGGCAGGGCTGGGATGG + Intronic
1166664348 19:44669830-44669852 CAGAGTGATCAGGGCTGGGATGG - Intronic
1166830466 19:45636515-45636537 CAGAGTGTGCAAGACTGGGATGG - Intronic
1166840876 19:45696184-45696206 CAGAGTGAGCAAGAGGTGAGGGG - Intronic
1166872320 19:45878375-45878397 CACGGTCAGCAAGGGTGGGAGGG - Intergenic
1167008789 19:46792638-46792660 CAGAGTGGGCAGGGCTGGGATGG + Intergenic
1167112012 19:47468174-47468196 CAGACTGGGCAAGGGGGAGAGGG - Intronic
1167173718 19:47850955-47850977 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1167229819 19:48275257-48275279 AAGAGAGAGGAAGGGAGGGAGGG + Intronic
1167284044 19:48588887-48588909 CCAAGTGAGCAAGTGGGGAAAGG + Intronic
1167517369 19:49930949-49930971 CATAGGGAGCCAGGGGGGCAGGG - Exonic
1167619602 19:50553410-50553432 GCGAGTGAGCAGGGGGAGGAGGG - Intronic
1167702058 19:51054639-51054661 CTGAGTGAGCAAGGAGGAGAGGG - Intergenic
1167723672 19:51196598-51196620 CAGAATGAGGAAGGGGGTGAGGG - Intergenic
1167884140 19:52486585-52486607 CAGAGTGAGGGAGAGAGGGAAGG + Intronic
1167889584 19:52528628-52528650 CAGAGTGAGGGAGAGAGGGAGGG + Intronic
1167898734 19:52602161-52602183 CAGAGTGAGGGAGAGGAGGAGGG + Intronic
1167903162 19:52637398-52637420 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167904556 19:52648019-52648041 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167913847 19:52724795-52724817 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167915050 19:52734049-52734071 CAGAGTGAGGGAGAGAGGGAAGG - Intronic
1167921351 19:52785791-52785813 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167925858 19:52820649-52820671 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167930044 19:52856638-52856660 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167934179 19:52892870-52892892 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167940355 19:52941693-52941715 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167946372 19:52992360-52992382 CAGAGTGAGGGAGAGGAGGAGGG - Intergenic
1167995211 19:53396116-53396138 CAGAGTGAGGGAGAGGAGGAGGG + Intronic
1168192680 19:54751217-54751239 GAGAGGGAGCAAGGGGGAGGGGG + Intronic
1168194768 19:54766045-54766067 GAGAGGGAGCAAGGGGGAGGGGG + Intronic
1168197018 19:54782490-54782512 GAGAGGGAGCAAGGGGGAGGGGG + Intronic
1168202814 19:54828929-54828951 GAGAGGGAGCAAGGGGGAGGGGG + Intronic
1168205375 19:54846752-54846774 GAGAGAGAGTAAGGGGGAGAGGG + Intronic
1168284118 19:55321957-55321979 CAGGCTGAGCATGGGTGGGAAGG + Intronic
1168683636 19:58334916-58334938 CAGAGTGAGCAATGTGGTCATGG - Exonic
1168725044 19:58576387-58576409 GAGAGGGAGGAAGGGAGGGAGGG - Intergenic
925296583 2:2781149-2781171 CAGAGTGTGAAGGTGGGGGAGGG - Intergenic
925436455 2:3842426-3842448 CAGGGTGAGGAAGGGGGTGGTGG + Intronic
925502987 2:4528038-4528060 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
925639138 2:5970880-5970902 CTGAGGGAGCAAGGGGATGAAGG - Intergenic
926086378 2:10022812-10022834 CAGAGAAAGGAAGGGAGGGAGGG - Intergenic
926240452 2:11081106-11081128 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
926386577 2:12341335-12341357 CAGAGAAAGTAAGGGGGGCAGGG - Intergenic
926913436 2:17872200-17872222 GAGAGAGAGGAAGGGAGGGAGGG - Intergenic
927434745 2:23057483-23057505 CAGAGAGAGGGAGGGAGGGAGGG + Intergenic
927468836 2:23357119-23357141 CAAGGAGAGCAAGGTGGGGAGGG + Intergenic
928105202 2:28466137-28466159 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
928373760 2:30759101-30759123 CAGAGGAAGAAAGGGAGGGAGGG - Intronic
929288359 2:40162076-40162098 CAGAGTGAGCCAGTTGGAGATGG - Intronic
929359333 2:41065570-41065592 CAGAGTGAACAAGTGTGGAAAGG + Intergenic
929685152 2:44027009-44027031 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
929793864 2:45043511-45043533 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
929964220 2:46521525-46521547 CAGACTGAGGAAGGAGGAGAAGG + Intronic
930248859 2:49013127-49013149 GAGAGTGAGAAAGTGGGGGTGGG - Intronic
930615226 2:53586832-53586854 CACAGTGAGGAAGAGGAGGAAGG + Intronic
930713048 2:54567221-54567243 CAGAGTGAGGATGGGGTGGTAGG + Intronic
931121622 2:59226376-59226398 GAGAGGGAGGAAGGGAGGGAGGG + Intergenic
931141414 2:59462511-59462533 CATGGTGAGCAAGGGGTGGTGGG - Intergenic
931152313 2:59587986-59588008 GAGAGAGAGGAAGGGAGGGATGG + Intergenic
932036393 2:68251731-68251753 CAGAGTGAGTGTGGAGGGGAGGG + Intronic
932110871 2:68998766-68998788 GAGAGAGAGGAAGGTGGGGAAGG + Intergenic
932400260 2:71475602-71475624 CAGAGTGGGCACAGAGGGGAGGG + Intronic
932552975 2:72790941-72790963 CAGAATGGGGAAGGGGAGGATGG + Intronic
932692912 2:73928621-73928643 TCGAGTGAGCAAGGATGGGAGGG + Intronic
932734086 2:74242179-74242201 CAAAGTGAGGAAGGTGGAGAGGG - Intronic
932765160 2:74464815-74464837 AAGCGAGAGCAAGGGTGGGAAGG - Intronic
932973133 2:76570182-76570204 CAGAGTGAGGAAGAGGGACAGGG + Intergenic
933466520 2:82658556-82658578 CAGAGTGTGCAACAGGGGGGTGG - Intergenic
933498784 2:83086146-83086168 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
934936015 2:98465933-98465955 GAGACTGAGCAAGGTGGGCAGGG - Intronic
935556845 2:104519365-104519387 CAGAGGGAGGGAGGGAGGGAAGG + Intergenic
935564901 2:104595770-104595792 GAGAGGGAGCAAGAGAGGGAAGG - Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937564871 2:123272584-123272606 CCAAGGGAGCAAGGTGGGGAGGG + Intergenic
937892409 2:126948634-126948656 CAGTGAGATCAAGGGGGGAAAGG - Intergenic
938610856 2:132946133-132946155 CAGAATCAGAAAGGAGGGGAAGG + Intronic
939350633 2:141033231-141033253 CAGAGAGAGCAAGGGAGGGGAGG + Intronic
940192303 2:151054897-151054919 CAGAGTGAGCAAGGGGCATGAGG - Intergenic
940511504 2:154620937-154620959 AAGAGAGAGCGAGGGAGGGAGGG - Intergenic
941405391 2:165080778-165080800 CAGAGAGAGCAAGAGAGAGAGGG - Intergenic
941432919 2:165433688-165433710 CAGAATGAGGAAGGGAGTGAAGG - Intergenic
941894428 2:170614926-170614948 ATTAGTGAGCAAGGGAGGGAGGG - Intronic
941997106 2:171611245-171611267 GAGAGGGAGCAAGGGAAGGAGGG - Intergenic
942541604 2:177020936-177020958 CAGTGTGAGCATGGGGGTGAGGG - Intergenic
942846481 2:180432368-180432390 AAGAGTGAGCCAGTGGTGGAAGG + Intergenic
944102692 2:196045328-196045350 AAGAGGGAGGAAGGGAGGGAGGG + Intronic
944839139 2:203608648-203608670 CAGAGGGAGTATGGAGGGGAGGG - Intergenic
944865178 2:203852845-203852867 AAGAGGGAGGAAGGGAGGGAGGG - Intergenic
945222965 2:207503487-207503509 CAGTGTGTGCATGGGAGGGAGGG - Intergenic
945994634 2:216425655-216425677 GAGAGTGAGCAAGGCAGAGAAGG + Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946294653 2:218774253-218774275 CAGAGAGAGAAAGGGAGGGAGGG + Intergenic
946612123 2:221470319-221470341 CAGAGAGAGAAAGGGCGGGGGGG + Intronic
946884363 2:224208348-224208370 CAGTGTGAGCAAGGAGAGGTTGG + Intergenic
947029927 2:225782561-225782583 GAGAGGGAGGAAGGGAGGGAGGG - Intergenic
947029937 2:225782589-225782611 CAGAGGGAGGAAGGGAGGGAGGG - Intergenic
947272117 2:228347955-228347977 GAGAGAGAGGAAGGGAGGGAGGG - Intergenic
947821319 2:233073070-233073092 CAGGGTGAGTGAAGGGGGGATGG - Intronic
947965706 2:234279858-234279880 CAGAGGGAGCAAGAGGTGGTTGG + Intergenic
948705536 2:239790014-239790036 CAAAGTGAGAAAGTGGGGGTGGG - Intronic
948836824 2:240629895-240629917 GAGAGTGAGCAGGGGGAGCAAGG - Intronic
949059685 2:241949604-241949626 CAGAGGGAGCCAGGGGAGGCAGG + Intergenic
1168745662 20:237634-237656 CTGAGTGAGGAAGGGGGAGTGGG + Intergenic
1168787821 20:555224-555246 AAGAGTGAGAATGGGGGAGAAGG + Intergenic
1168809411 20:694454-694476 CACAGTGAACAAGGGGGTGCAGG + Intergenic
1168826780 20:819389-819411 GAGAGGGAGGAAGGGAGGGAGGG - Intergenic
1168878893 20:1189704-1189726 GAGAGGGAGCAAGAGGGAGAGGG - Intergenic
1169000333 20:2163631-2163653 CAGAGGAAGCAAGGGGAAGAAGG + Intronic
1169001636 20:2172219-2172241 CAGAGGGAGCAGGGAGGGCAAGG - Intronic
1169025682 20:2369180-2369202 AAGAGCCAGCAAGGGAGGGATGG - Intergenic
1169235558 20:3927134-3927156 CATAGTGTGCAAGCGGGGGTGGG - Intronic
1169939804 20:10924769-10924791 CAGAGTCAGGAGGGGTGGGAAGG - Intergenic
1170194985 20:13680496-13680518 CATAGAGAGCAAGGTGGTGATGG - Intergenic
1170637209 20:18117606-18117628 GAGAGAGAGGAAGGGAGGGAGGG + Intergenic
1170709084 20:18774082-18774104 AAGAGAGAGGAAGGGAGGGAGGG + Intergenic
1170894713 20:20402909-20402931 CTGAGTGAGCCAGGGTGGGCAGG - Intronic
1171096363 20:22336028-22336050 CAGAGAGAGGCAGGGAGGGAGGG - Intergenic
1171210101 20:23310368-23310390 CAGGGTGAGGAAGTGGGGGTGGG - Intergenic
1171823776 20:29876906-29876928 GAGAGAGAGCAAGGTGGAGAGGG - Intergenic
1171896311 20:30813441-30813463 GAGAGAGAGCAAGGTGGAGAAGG + Intergenic
1172031497 20:31985181-31985203 CAGAGTGAACAGGGTGGGGCTGG - Intronic
1172204657 20:33154477-33154499 CAGAGGGAGACAGGGGGCGACGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172777175 20:37414549-37414571 CAGAGACAGCGAGGGGAGGAAGG - Intergenic
1172778912 20:37424162-37424184 CAGAGAGAGAATGGGAGGGAGGG + Intergenic
1172939135 20:38642744-38642766 CGGAGTGAAGAAGGGAGGGAGGG - Intronic
1172943351 20:38669738-38669760 GAGAGAGAGAAAGGGAGGGAAGG + Intergenic
1173089026 20:39952500-39952522 GAGAGTGAGGAAAGGAGGGAGGG + Intergenic
1173305166 20:41841153-41841175 CGGAGGGAGGAAGGGAGGGAAGG - Intergenic
1173305212 20:41841281-41841303 CAGAGGGAGGCAGGGAGGGAAGG - Intergenic
1173539425 20:43840503-43840525 CAGAGTGATCAAGGAGGAGTGGG + Intergenic
1173662675 20:44745405-44745427 CGGAGGGAGGAAGGGAGGGACGG + Intergenic
1173662683 20:44745425-44745447 CGGAGGGAGGAAGGGAGGGACGG + Intergenic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173838737 20:46142453-46142475 CAGAGTGAGCAAGGGAGAGAGGG - Intergenic
1174111860 20:48202676-48202698 CTGAGTGAGCACGGGCGGGTGGG - Intergenic
1174169277 20:48606146-48606168 CTGAGTGAGCACGGGCGGGTGGG + Intergenic
1174190275 20:48735483-48735505 CAGAGTGAGCTGGGGTGGGCTGG - Intronic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1174532004 20:51221731-51221753 CAGAGGGAGCAAGGGGTGGGAGG + Intergenic
1174790072 20:53469760-53469782 GAGAGGGAGGAAGGGAGGGAGGG + Intronic
1174790090 20:53469828-53469850 GAGAGGGAGGAAGGGAGGGAGGG + Intronic
1174826110 20:53770354-53770376 CAGGGTGATTAAGGTGGGGAAGG - Intergenic
1175151566 20:56939140-56939162 GAGAGAGAGAAAGGGAGGGAAGG + Intergenic
1175279590 20:57794168-57794190 GAGAGTGAGGAGGGTGGGGATGG + Intergenic
1175392507 20:58636120-58636142 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1175879674 20:62250011-62250033 CAGAGTGAGCCTTGGGGGCAGGG - Intronic
1175996879 20:62816036-62816058 GTGAGTTAGCAAGGGCGGGAGGG - Intergenic
1176057028 20:63154422-63154444 GAGGGGGAGCAAGGTGGGGAAGG + Intergenic
1176257578 20:64160180-64160202 CCGAGAGAGGAAGCGGGGGAAGG + Intronic
1176430345 21:6571528-6571550 AAGAGTGAGCAAGGGGGCTCAGG - Intergenic
1177188271 21:17821386-17821408 GAGAGTGAGCAAGAGAGAGAGGG + Intergenic
1177658891 21:24056677-24056699 GAGAAGGAGCAAGGTGGGGACGG - Intergenic
1177786349 21:25675534-25675556 GAGAGAGAGGAAGGAGGGGAAGG + Intronic
1177817270 21:25991157-25991179 CAGAATGAGGAAGAGTGGGAAGG + Intronic
1177963254 21:27695396-27695418 AAGAGAGAGGAAGGGAGGGAGGG - Intergenic
1178198339 21:30374451-30374473 GAGAGGGAGAAAGGGAGGGAAGG - Intronic
1178226515 21:30725443-30725465 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1178432865 21:32531808-32531830 CAGAGTGAGACAGGGAGGGAGGG + Intergenic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1178976594 21:37226249-37226271 CAGTGTGAGGAGGGGTGGGAAGG + Intronic
1179705739 21:43178990-43179012 AAGAGTGAGCAAGGGGGCTCAGG - Intergenic
1179791352 21:43757615-43757637 CAGAGTGGGAGAGTGGGGGAGGG - Exonic
1180065154 21:45408717-45408739 CACAGTGAGCGGGGGTGGGAGGG - Intronic
1180457244 22:15520890-15520912 GAGAGGGAGAAAGGTGGGGAGGG - Intergenic
1181450636 22:23017536-23017558 CAGAGCGACCAAGGGGTGGGAGG + Intergenic
1181729914 22:24837581-24837603 CAGACTGGGAAAGGGGGGGGGGG - Intronic
1181774195 22:25147986-25148008 GAGAGTGAGGTAGGGAGGGAGGG - Intronic
1182001746 22:26925631-26925653 CAGAGTGAGCAATAGGGAAAGGG - Intergenic
1182377738 22:29860415-29860437 AAGAGGGAGGAAGGGAGGGAGGG - Intergenic
1182419779 22:30243346-30243368 CAAAGTGAGCAAGGGGCCAAAGG + Exonic
1182565535 22:31195714-31195736 GAGAGTCAGCTAGGAGGGGAGGG + Intronic
1182735375 22:32529310-32529332 CAGGGTGAGAAAGGAGGGGGCGG - Intronic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183162793 22:36126357-36126379 GAGAGGGAGGAAGGGAGGGAGGG - Intergenic
1183661023 22:39221352-39221374 CAGAGTGAGAAAGGGGGGCTTGG + Intergenic
1183694731 22:39415305-39415327 TAGCGTGAGCATGGGGAGGAGGG + Intronic
1183727074 22:39596115-39596137 CAGAGTGAGCCAGGGCAGGGCGG + Intronic
1183888335 22:40903851-40903873 CAGAGAGAGAGATGGGGGGAGGG - Intronic
1184237212 22:43189313-43189335 CAAAGTGAGCATGGGGAGAAAGG - Intergenic
1184256347 22:43289218-43289240 CAGAGTGAGCAAGTGCGGGGAGG - Intronic
1184327182 22:43797816-43797838 CAGAGGGAGCCGGGGGAGGATGG - Intronic
1184335955 22:43853417-43853439 CAGAGTGGGCAGGGGTGGGGTGG - Intronic
1184486474 22:44783059-44783081 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
1184567610 22:45301558-45301580 CAGGGTGGGCAGGGGTGGGATGG - Intergenic
1184642448 22:45879623-45879645 GGGAGGGAGGAAGGGGGGGAAGG - Intergenic
1185110176 22:48896325-48896347 CAGAGTGGGGATGGGGCGGAGGG + Intergenic
1185123914 22:48993364-48993386 CAGAGTGTGCAAGGCGGGGGTGG - Intergenic
949326382 3:2869675-2869697 TAATGTGAGCAAGGTGGGGAAGG - Intronic
949332504 3:2937835-2937857 CAGAGAGAGGAAGAGAGGGAAGG + Intronic
949334333 3:2957588-2957610 TAGAGTGGGGAAGGTGGGGAGGG - Intronic
949371889 3:3344170-3344192 CAGGATGAGCAAGGGGTAGAGGG - Intergenic
949508011 3:4744864-4744886 GAGAGGGAGGAAGGGAGGGAGGG - Intronic
950795904 3:15510689-15510711 CAGAGTGAGACAAGGAGGGAAGG + Intronic
950991012 3:17437636-17437658 GAGAGAGAGGAAGGGAGGGAGGG + Intronic
951058818 3:18180115-18180137 CAGAGTGACATAGGGAGGGAGGG + Intronic
951295291 3:20926315-20926337 TAGAGGGAGCAAGAGAGGGAAGG + Intergenic
951339815 3:21471242-21471264 GAGAGAGAGAAAGGGAGGGAGGG - Intronic
951924309 3:27890486-27890508 CAGAGAGAGCGAGAGGGAGAGGG - Intergenic
952033262 3:29170201-29170223 GAGAGAGAGGAAGGGGGGGAAGG + Intergenic
952068428 3:29601933-29601955 CAGAGTTCCCAAGGTGGGGAAGG - Intronic
952407077 3:33014330-33014352 CACAGTGAGCTGGGGAGGGAAGG + Intronic
952479499 3:33746592-33746614 CAGTGGGAGCAAGGGAGGGGAGG - Intergenic
953298812 3:41750992-41751014 GAGAGAGAGGAAGGGAGGGAAGG + Intronic
953397666 3:42585945-42585967 CTGGGAGAGCAAGCGGGGGAGGG - Intronic
953404910 3:42655257-42655279 CAGACTGAGCAAGGGGGCACAGG - Intronic
953737479 3:45508835-45508857 GAGAGGGAGGAAGGGAGGGAAGG - Intronic
953805785 3:46066208-46066230 GAGAGAGAGCGAGGGAGGGAGGG - Intergenic
954091499 3:48287915-48287937 GAGAGTGAGGAAGGGGGAGGAGG + Intronic
954131460 3:48563211-48563233 CAGAGTGACAGAGCGGGGGATGG + Intronic
954155469 3:48682750-48682772 CCCAGTGAGCAAGGTGGGGTCGG - Intronic
954593089 3:51800932-51800954 CAGAGTAAGGGAGGGGGAGAGGG + Intergenic
954625434 3:52019705-52019727 CAGAGCCAGCAAGGGAGGGGTGG + Intergenic
954665190 3:52247810-52247832 GAGGGTGGGCAAGGGTGGGATGG + Intronic
954982643 3:54760392-54760414 AACAGTGAGCAAGAGGGAGATGG + Intronic
955092010 3:55761932-55761954 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
955092021 3:55761962-55761984 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
955269949 3:57487313-57487335 GAGAGAGAGAAAGGGAGGGAGGG + Intronic
955496448 3:59538290-59538312 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
955973903 3:64462794-64462816 TAGAGGGAGGAAGAGGGGGAGGG - Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
957085329 3:75671975-75671997 GAGAGAGAGCAAGGTGGAGAGGG + Intergenic
957556533 3:81769276-81769298 GAGAGGGAGGAAGGGAGGGAGGG - Intergenic
957756730 3:84498597-84498619 GAGAGAGAGAGAGGGGGGGAGGG + Intergenic
958448266 3:94241357-94241379 GGGAGGGAGCAAGGGAGGGAGGG - Intergenic
960620510 3:119632414-119632436 CAGAGTGAGCAAAGTGGGTGTGG - Intergenic
961006667 3:123410161-123410183 GAGAATGAGAAAGGGAGGGAAGG + Intronic
961066367 3:123880594-123880616 CAGAGGGTGGAAGGGGGGCAAGG + Intronic
961107632 3:124255728-124255750 CAGATGGAGCAGGGTGGGGAGGG + Intronic
961372389 3:126439656-126439678 CACAGTGAGGAAGGGGAGGAAGG + Exonic
961474861 3:127140273-127140295 GAGAGTGAGCGAGAGGGTGAGGG + Intergenic
962273285 3:133993942-133993964 CAGAGTGAGAAAGTGGGGCTTGG + Intronic
962585649 3:136840504-136840526 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
962618154 3:137149282-137149304 CAGAGTGATCAAGGTGGACATGG - Intergenic
962619921 3:137168012-137168034 GAGAGGGAGGAAGGGAGGGAGGG - Intergenic
962619930 3:137168036-137168058 GAGAGGGAGGAAGGGAGGGAGGG - Intergenic
962668220 3:137678242-137678264 GAGAGGGAGGAAGGGAGGGAGGG + Intergenic
962886384 3:139631818-139631840 CAGAGTTAGCATGGTGGTGAGGG - Intronic
963075875 3:141345794-141345816 TAGAATGGGCAAGGGAGGGATGG - Intronic
963104410 3:141634077-141634099 CAGTGTGAGCTAGGGTGTGAAGG + Intergenic
963613718 3:147507504-147507526 AAGAGTGAGAATTGGGGGGAGGG - Intronic
964377274 3:156060611-156060633 CAGAGAGAGGCAGGGAGGGAAGG - Intronic
964934296 3:162062147-162062169 CAGAGGGAGGGAGGGAGGGAAGG - Intergenic
964949084 3:162265101-162265123 CTCAGTGAGCAGGGGGTGGAAGG - Intergenic
964977681 3:162639914-162639936 GAGAGTGAGCAAGGGCTGCAAGG - Intergenic
965360723 3:167735225-167735247 CAGAGGAAGGAAGGGGGTGAGGG + Intronic
965722603 3:171678069-171678091 CAGAGTGGGAAGGGCGGGGAGGG + Intronic
965971177 3:174558338-174558360 CAGACTGGGTACGGGGGGGATGG + Intronic
966463194 3:180200667-180200689 CAGATTGAGTCAGGAGGGGAGGG - Intergenic
966621397 3:181968140-181968162 CAGAGTGAGAAAGTGGAGGCCGG + Intergenic
966695279 3:182783750-182783772 CAGAGGGGGCAAGAGGAGGAAGG + Intergenic
966778648 3:183564647-183564669 CAGAGAGAGGGAGGGAGGGAGGG - Intergenic
967226008 3:187291812-187291834 CAGAGGGAGAGAGGGGGAGAGGG - Exonic
967229173 3:187321306-187321328 CAGAGTGAAAAAGGCAGGGACGG + Intergenic
967683461 3:192392626-192392648 GAGAGAGAGGAAGGGAGGGAGGG + Intronic
968191419 3:196670475-196670497 CAGAGAGAGCAAGGAGGAGGGGG + Intronic
968546228 4:1200388-1200410 CAGAGGGAGCAAGTGGAGGGAGG + Intronic
968871162 4:3243307-3243329 CAGAGGGAGGAAGCGGGGGAGGG - Exonic
968914247 4:3490269-3490291 ATGAATGAGCAAGGTGGGGAAGG - Intronic
968957378 4:3726187-3726209 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
968957417 4:3726356-3726378 GAGAGAGAGGAAGGGAGGGAAGG + Intergenic
968957448 4:3726481-3726503 GAGAGAGAGGAAGGGAGGGAGGG + Intergenic
968991640 4:3917339-3917361 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
969040188 4:4289967-4289989 GAGAGTGAGTAGGGGAGGGACGG - Intronic
969437926 4:7199318-7199340 CAGGGAGAGCAAGGTGGGGCAGG + Intronic
969481348 4:7448676-7448698 CAGAGAGAGGAAGGAAGGGAAGG - Intronic
969481403 4:7448854-7448876 GAGAGGGAGGAAGGGAGGGAGGG - Intronic
969481461 4:7449015-7449037 GAGAGGGAGGAAGGGAGGGAGGG - Intronic
969481530 4:7449193-7449215 GAGAGGGAGGAAGGGAGGGAGGG - Intronic
969607746 4:8211055-8211077 CAGAGGGAGAGAGGGAGGGAGGG - Intronic
970929851 4:21496883-21496905 CAGACAGAGCAGGGCGGGGATGG - Intronic
971186974 4:24387962-24387984 GAGAGGGAGAAAGGGAGGGAGGG + Intergenic
971419801 4:26464912-26464934 CTGAGTAAGAAAGGAGGGGAGGG + Intergenic
972682275 4:41317839-41317861 GTGAGTGAGCAAAGGGGGAAAGG + Intergenic
972924173 4:43983642-43983664 CAGAGGGAGAGAGGGAGGGAGGG + Intergenic
973061785 4:45735466-45735488 GAGAGAGAGGAAGGGAGGGAGGG - Intergenic
974374779 4:61062144-61062166 CAGAGAGAGAGAGGGGAGGAAGG + Intergenic
974551384 4:63379671-63379693 AAGGGTGAGCAAGGTGGAGATGG - Intergenic
974848485 4:67380194-67380216 CAGAGGGAGGGAGAGGGGGAGGG - Intergenic
975156732 4:71080577-71080599 CAAAGTGAGAAAGGCAGGGATGG - Intergenic
975851593 4:78578321-78578343 GAGAGAGAGAAAGGGAGGGAGGG + Intronic
976164572 4:82240538-82240560 AAGAAAGAGCAAGGGAGGGAGGG + Intergenic
976419790 4:84828073-84828095 CAGAGGGAGGGAGGGAGGGAGGG + Intronic
977163165 4:93662015-93662037 CAGAATGAGCAAGGGTTGGGGGG - Intronic
977245156 4:94622685-94622707 CAGAGTGAGGGAGGAAGGGAAGG - Intronic
977470774 4:97438601-97438623 GAGAGTGAGCAAGGGCTGCAAGG + Intronic
978071624 4:104479769-104479791 CAGAGGGAGGGAGGGAGGGAAGG - Intronic
978204424 4:106063577-106063599 GAGCTTGAGCAAAGGGGGGAAGG + Intronic
978733812 4:112062527-112062549 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
978773849 4:112486088-112486110 CAGAATGAGAGAGGAGGGGATGG + Intergenic
978952213 4:114574368-114574390 AAGAGAGAGGAAGGGAGGGAGGG - Intergenic
979041037 4:115795502-115795524 CTCAGTGAGAAAGGGTGGGAAGG - Intergenic
979321765 4:119332908-119332930 GAGAGTGAGAAATGTGGGGATGG - Intergenic
979349699 4:119629117-119629139 CAGAGTGCCCCAGGGAGGGAAGG + Intergenic
980610280 4:135151525-135151547 CAGAGTGAGCAAGGACGGTTAGG - Intergenic
980710346 4:136558005-136558027 CATTGTGAGGAAGGGAGGGAGGG + Intergenic
981241481 4:142481457-142481479 CAGAGTGAGAAATTGAGGGAAGG + Intronic
981315369 4:143336129-143336151 GGGAGGGAGCAAGGGAGGGAGGG - Intergenic
981417842 4:144513920-144513942 CAGAGAGAACAAGGAGGGAAGGG + Intergenic
981503866 4:145479607-145479629 CAGAGTGCTAAAGGAGGGGAAGG + Intergenic
981579389 4:146236702-146236724 GAGAGACAGCAAGGGAGGGAGGG + Intergenic
981610571 4:146589808-146589830 CATAGTGAGCCTGGGGTGGAGGG + Intergenic
982232415 4:153221734-153221756 AAGAGTGAGGAAGGGAGGGAGGG + Intronic
983568603 4:169180550-169180572 CAGAGTAAACAAGGGGAGTATGG + Intronic
984200469 4:176714301-176714323 GAGTGTGAGCAAGAGAGGGAAGG - Intronic
984934937 4:184881830-184881852 CAGAGGGAGCAAGTGGGGCAAGG + Intergenic
985756627 5:1723367-1723389 GAGAGGGAGGAAGGGAGGGAGGG - Intergenic
985781387 5:1873710-1873732 CAGAGGGAAGAAGTGGGGGAGGG - Intergenic
985781578 5:1874423-1874445 CAGAGAGAGTAAGGGAGAGAGGG + Intergenic
985838857 5:2290813-2290835 GAGAGAGAGAAAGGGAGGGAGGG - Intergenic
986206375 5:5628719-5628741 GTGAGGGAGCAAGGGAGGGAGGG + Intergenic
986253655 5:6083608-6083630 CTGAGTGAGCCAGGGGATGAAGG - Intergenic
986286038 5:6359933-6359955 CAGAGTGAGCACGGGAGCGCAGG + Intergenic
986384237 5:7216204-7216226 AAGAGTGGGCATGGGGTGGAGGG + Intergenic
988280092 5:29134262-29134284 CAGGGAGGGCAAGGGGGGGATGG + Intergenic
989042191 5:37240508-37240530 GAGAGGGAGCAAGGGAGAGAAGG + Intronic
989116700 5:37961621-37961643 CAGAGTGAGGCAGGGAGGGGTGG + Intergenic
989300330 5:39884135-39884157 TAGAGTGAGTGATGGGGGGAGGG - Intergenic
990317854 5:54601068-54601090 CAGAGGGAGGACGGGAGGGATGG - Intergenic
990513462 5:56510578-56510600 CAGAATGAGCAAGGGGGGCAGGG - Intergenic
990554558 5:56918179-56918201 TGGAGTGAGCAAGGGGAGAAAGG - Intergenic
990801349 5:59607587-59607609 CACAGTGAGCTTGGAGGGGAGGG + Intronic
991715475 5:69447333-69447355 AAGAGAGAGGAAGGGAGGGAGGG + Intergenic
992501407 5:77347810-77347832 CAGAGAGAGCACGTGGGGAAAGG + Intronic
992642436 5:78779745-78779767 CAGAGTGAGCAATGGCTGGGGGG + Exonic
992792759 5:80228216-80228238 CAGAGTGAGTGAGGGAGGGAGGG + Intronic
993604459 5:89971262-89971284 TAGAGAGAGGAAGGGAGGGAGGG + Intergenic
993664711 5:90681808-90681830 CGGAGTGAGGGAGGGAGGGAGGG - Intronic
994100202 5:95883204-95883226 CTAAGTGAGGAAGGGGTGGAGGG + Intergenic
994578609 5:101611426-101611448 GAGAGTGAGCAAGGCGGAGAAGG + Intergenic
995551414 5:113285499-113285521 CAGAGTGAGCAGGGGGAGAGTGG - Intronic
995561671 5:113388576-113388598 GAGAGGGAGCAAGGTGGGGGAGG - Intronic
995782182 5:115789299-115789321 GAGAGGGAGCAAGGGGGTGGGGG - Intergenic
995815112 5:116158499-116158521 CTGAGGGAGAAAGGGGGGGGAGG - Intronic
995896807 5:117022673-117022695 TAGAGAGAGAAAGGGAGGGAGGG - Intergenic
996105717 5:119499996-119500018 TAGAGTGAGCAAGGGGGCAATGG + Intronic
996155224 5:120090875-120090897 AAGAGAGAGAAAGAGGGGGAGGG - Intergenic
996279038 5:121705071-121705093 CAGAGAGAGAGAGGGAGGGAGGG + Intergenic
996627872 5:125591232-125591254 CAGTCTGAGCAAGGATGGGAGGG + Intergenic
996900638 5:128538443-128538465 AAGAGGAAGGAAGGGGGGGAGGG + Intronic
997259140 5:132452350-132452372 GGGAGTGAGAAAGGCGGGGAAGG - Intronic
997615921 5:135246146-135246168 GAGAGTGAGCAGGGAGGGGCAGG + Intronic
998381443 5:141728892-141728914 GAGAGGGAGGAAGGGGGGGAGGG - Intergenic
998674275 5:144389651-144389673 CAGATTGGGCCAGGTGGGGATGG - Intronic
998884242 5:146677531-146677553 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
999118644 5:149188604-149188626 CAGAGAGAGAAAGGGAGAGAGGG + Intronic
999227924 5:150042595-150042617 CAGAGTGTGGGAGGGAGGGAGGG + Intronic
999470302 5:151849311-151849333 GAGAGAGAGAAAGGGAGGGAGGG - Intronic
999721515 5:154402232-154402254 CAGAGGGAGAAAGGGGAAGAGGG - Intronic
999820993 5:155228583-155228605 CAGAGTAAGCAAGCGGAGAATGG + Intergenic
999857726 5:155613454-155613476 CAGAGTGAGCCAGGGAGGGAGGG + Intergenic
1000115722 5:158151726-158151748 CAGAGCGAGGAAGGAAGGGAGGG - Intergenic
1000209708 5:159098117-159098139 CAGAGTGCGGAAGGGGAAGAAGG - Intronic
1000391359 5:160726630-160726652 CAGAGAGAGCAAGGGGGTGGGGG + Intronic
1000822192 5:165998401-165998423 TATAGTGAGCAAGGAGGGGATGG - Intergenic
1000926222 5:167197918-167197940 GAGAGGGAGAAAGGGAGGGAGGG + Intergenic
1000958725 5:167573522-167573544 CAGAGAGAGAGAGGGGGAGAGGG - Intronic
1001408713 5:171495304-171495326 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1001542047 5:172546408-172546430 CAGAGTGAGCGAGGGCAGGGGGG + Intergenic
1001570672 5:172728537-172728559 CAGAGAGAGCAAGAGAGGGGTGG + Intergenic
1001583098 5:172813247-172813269 GAGAGTCAGCAAGGGGTGGTGGG + Intergenic
1001763891 5:174229758-174229780 CAGTATGAGGAAGGAGGGGAAGG - Intronic
1001907904 5:175488234-175488256 CGGAGTGAGGAAGTGGGAGATGG - Intronic
1001951780 5:175821298-175821320 CTGAGTCAGGAAGGGGGTGAAGG - Intronic
1002059737 5:176619419-176619441 CAGAGTGAGAAAGATGGGGGCGG - Intergenic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1003020120 6:2502512-2502534 AAGAGAGAGCAAGGGCAGGAGGG + Intergenic
1003241188 6:4347108-4347130 CACAGTGAGGAAGGTAGGGAAGG - Intergenic
1003860812 6:10320084-10320106 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
1004405784 6:15332113-15332135 CAGAGTGAGGAAGGAAGGGTGGG + Intronic
1004882508 6:20022914-20022936 CAGAGAGAGCATGGTGGGGGAGG - Intergenic
1004883030 6:20027400-20027422 CAGAGGGAGCAAGAAGGGGCTGG + Intergenic
1005453407 6:25995617-25995639 CAGGGTGAGCAAGGGTGTGGAGG - Intergenic
1005770243 6:29062829-29062851 GAGAGAGAGAAAGGGAGGGAGGG - Intergenic
1005932343 6:30492942-30492964 CAGTGTGAGGAAGGGGGTCATGG - Exonic
1006034235 6:31199076-31199098 GAGAGAGAGGAAGGGAGGGAGGG + Intronic
1006144305 6:31949148-31949170 CAGGGTGAGCAAGTTGAGGAAGG - Intronic
1006449555 6:34098396-34098418 CAGAGTCAGCAAGGAGGGTGGGG - Intronic
1006449683 6:34098926-34098948 CAGAGGGAGGGAGGGAGGGAAGG - Intronic
1006456457 6:34134726-34134748 CAGAGGGAGGAAGTGGGGGTGGG - Intronic
1006738700 6:36292656-36292678 GGGAGTGAGCAAGTGGGTGACGG - Intronic
1006840632 6:37026061-37026083 CAGAGAGAGGAAGAGGGAGAGGG - Intronic
1007267337 6:40606886-40606908 CAGAGAGAGAGAGGGAGGGAGGG - Intergenic
1007823424 6:44579309-44579331 GAGAGGGAGGAAGGGAGGGAGGG - Intergenic
1007835628 6:44671676-44671698 GTGAGAGAGCAAGGGGGTGAAGG - Intergenic
1007837193 6:44682683-44682705 CAGAGAGAGGAAAGGAGGGAAGG - Intergenic
1008629929 6:53353883-53353905 CAGAGTGTGAAAGGCAGGGAGGG - Intergenic
1008837504 6:55853330-55853352 GAGAGAGAGAAAGCGGGGGAGGG - Intronic
1008869930 6:56261155-56261177 CAGAGTGAGGGAGAGGGAGAGGG - Intronic
1008944498 6:57082985-57083007 CAGATTGAGCAAGGGTGCTAAGG + Intergenic
1009404301 6:63293010-63293032 CAGAGTGGGGTAGGGGGGTAAGG + Intronic
1009739206 6:67722893-67722915 GAGAGTGAGCAAGGGCTGCAAGG - Intergenic
1010772335 6:79845901-79845923 GAGAGAGAGGAAGGGAGGGAGGG + Intergenic
1011043542 6:83057371-83057393 CAGAGTGAACAAGGTAGGGGAGG - Intronic
1012329082 6:97961806-97961828 GGGAGTGAGGAAGGGAGGGAGGG - Intergenic
1012337309 6:98077080-98077102 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1012626707 6:101413252-101413274 CAAAGAGAGGAAGGGAGGGAGGG - Intronic
1012671275 6:102050779-102050801 TAGAGGGAGAAAGGGAGGGAGGG + Intronic
1013146512 6:107399469-107399491 CAGATTGGCCAAGGGTGGGAAGG - Intronic
1013272337 6:108556849-108556871 CACAGTGAGGAATGGGGGGCAGG - Intergenic
1013425865 6:110012118-110012140 GAGAGGGAGCAAGGGGAGAATGG - Intergenic
1013432765 6:110069788-110069810 CAGAGTGAGCCAAGAGGAGAGGG - Intergenic
1013586663 6:111584957-111584979 CAGAGTGAGCAAGGAGAGAATGG - Intronic
1014587129 6:123212544-123212566 CAGAGTGAGCAAGAGAGGGAGGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015310491 6:131761971-131761993 GAGAGAGAGGAAGGGAGGGAGGG - Intergenic
1015979742 6:138826871-138826893 GAGAGTGAGACAGTGGGGGATGG - Intronic
1016167797 6:140969198-140969220 CAGAGAGAGAAAGGGGGAGGGGG + Intergenic
1016183193 6:141171795-141171817 GAGAGAAAGCAAGGGGAGGAGGG + Intergenic
1016660210 6:146569715-146569737 GAGAGTGAGGCAGGGGCGGAAGG - Intergenic
1016925765 6:149346113-149346135 GAGAGGGAGGAAGGGGTGGATGG + Intronic
1017193515 6:151677798-151677820 CAGAGTTTGCAAAGGGAGGAGGG + Intronic
1017274437 6:152549472-152549494 CAGAGTGAGGGAGGAGGAGAAGG - Intronic
1017432345 6:154383382-154383404 CAGAGTGAGCCAGCGTGGCAGGG - Intronic
1017711515 6:157172988-157173010 CAGAGTGAGGAAGAGAGGGAAGG - Intronic
1017926847 6:158917959-158917981 CTGAGTGGGGAATGGGGGGAAGG + Intergenic
1018323216 6:162635306-162635328 CAGAATGAGAAAGAGGGGAAGGG - Intronic
1018657975 6:166058248-166058270 AAGAGTGAGCGGGGGGGGGGCGG - Intergenic
1018918750 6:168156068-168156090 CAGCGTGTGCACCGGGGGGATGG - Intergenic
1019209987 6:170397301-170397323 CAGAGAGAGTGAGGGAGGGATGG - Intronic
1019273969 7:166266-166288 GAGAGGGAGGAAGGGAGGGAAGG - Intergenic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019631920 7:2053991-2054013 CAGAGGGAGGCAGGGCGGGAGGG + Intronic
1019929213 7:4212501-4212523 CAGAGAGGGCATGGGAGGGACGG + Intronic
1020032168 7:4940737-4940759 GAAACTGAGCAAGGGGTGGAAGG + Intronic
1020206029 7:6116984-6117006 GAGAGGGAGGAAGGGAGGGAGGG - Intronic
1020240411 7:6390066-6390088 GGGAGGGAGCAAGGGAGGGAGGG - Intronic
1020815132 7:12895995-12896017 CAGAGAGAGAGAGTGGGGGAGGG - Intergenic
1020877241 7:13713465-13713487 CAGAGGGAGGGAGGGAGGGAAGG + Intergenic
1021710228 7:23408965-23408987 GAGAGTGGGGATGGGGGGGATGG + Intronic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022194259 7:28049059-28049081 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
1022383845 7:29884270-29884292 CAGAGGGAGCGGGGGCGGGATGG - Exonic
1022428823 7:30294993-30295015 CAGAGAGAGAGAGGGAGGGAAGG + Intronic
1022483558 7:30760000-30760022 GAGAGTGGGCAAGGGTGTGAGGG + Intronic
1022633406 7:32107358-32107380 AGGAGGGAGCAAGGGAGGGAAGG + Intronic
1022638641 7:32160837-32160859 AAGAGAGAGAAAGGGAGGGAGGG + Intronic
1022896525 7:34755306-34755328 CAGAGTCAGTCAGGGTGGGAGGG + Intronic
1023387053 7:39669207-39669229 GAGATGGAGCAAGAGGGGGAGGG - Intronic
1023521960 7:41058315-41058337 CAGATTGAGCAAGAGAGGAAGGG - Intergenic
1023878826 7:44307256-44307278 GGGTGTGAGCAAGGGGAGGAGGG + Intronic
1024268504 7:47624756-47624778 CAGAGTGAGAAAGTGGGGCTGGG + Intergenic
1024483986 7:49895197-49895219 CACAGTGGGCAGGGGAGGGATGG + Intronic
1024525973 7:50349665-50349687 CTGAGTGGGCATGGGGGTGATGG + Intronic
1024612414 7:51078929-51078951 CAGAGTGAGCAAGTGAGCGAGGG + Intronic
1024692881 7:51821685-51821707 CAAAGTGAGCAAGTGAGTGAGGG + Intergenic
1024702165 7:51915840-51915862 CAGAGGGAGAAAGGGGAGCAAGG + Intergenic
1025626905 7:63230830-63230852 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1026370124 7:69690874-69690896 GAGGGTGAGCAAGGCGGAGAGGG + Intronic
1026655458 7:72252628-72252650 CAGAGGAAGGAAGGGAGGGAGGG + Intronic
1026833006 7:73621751-73621773 GAGAGGGAGGAAGGGAGGGAGGG - Intronic
1027416864 7:77983332-77983354 CAGAGGGAGGGAGGGAGGGAAGG - Intergenic
1028424701 7:90673413-90673435 CAGAGGGAGGGAGGGAGGGAGGG - Intronic
1028967635 7:96820386-96820408 CAGAGAGAGAAAGAGAGGGAGGG - Intergenic
1029043382 7:97600911-97600933 CAAGGTGAGCAAGGGGAAGAAGG + Intergenic
1029264158 7:99325448-99325470 CAGAGGGAGCACGGCGGGGGCGG + Intergenic
1029547088 7:101216327-101216349 CTGGGTGAGGAAGGGGAGGATGG + Intronic
1029609093 7:101617131-101617153 CACAGTGAACAAGGGGGACATGG - Intronic
1029887611 7:103889645-103889667 CAGATTGAGAAAGGGGGGCAGGG + Intronic
1030203414 7:106928742-106928764 AAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1030497143 7:110314444-110314466 TGGAGTGAACAAGGAGGGGAAGG - Intergenic
1031196869 7:118627072-118627094 GAGAGTGAGCAAGGCAGGGAAGG - Intergenic
1032071589 7:128811056-128811078 CAGCGTGGGCAAGGAGGGGCAGG + Intronic
1032167256 7:129555372-129555394 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1032305104 7:130725762-130725784 AAGAGGGAGGAAGGGAGGGAGGG - Intergenic
1032383530 7:131506358-131506380 CAGAGCGAGGCAGTGGGGGACGG + Intronic
1032449993 7:132022435-132022457 GAGAGGGAGGAAGGGAGGGAAGG - Intergenic
1032629336 7:133630404-133630426 CAGAGAGAGGGAGGGAGGGAAGG - Intronic
1032825200 7:135561935-135561957 CAGAGTGAGGGAGGGAGGGAAGG - Intronic
1032898116 7:136275297-136275319 GAGAGGGAGCGAGGGAGGGAGGG - Intergenic
1032991878 7:137403012-137403034 CAGAGTGTGCAGGGTGGCGAAGG + Intronic
1033238321 7:139656107-139656129 CAGAGTGAGGGAGTGGGAGAAGG - Intronic
1033911032 7:146263253-146263275 GGGAGTGAGCGAGGGAGGGAGGG + Intronic
1033997392 7:147368045-147368067 AAGAGAGAGGAAGGGAGGGAGGG - Intronic
1034065886 7:148136104-148136126 CGGAGGGAGGAAGGGAGGGAAGG + Intronic
1034252896 7:149706554-149706576 GAGGGAGAGAAAGGGGGGGAAGG - Intergenic
1035121988 7:156576564-156576586 CAGAGTGAGCCCAGGGGGAAGGG - Intergenic
1035789256 8:2288886-2288908 GAGAGAGAGCAAGGTGCGGACGG - Intergenic
1035803549 8:2432819-2432841 GAGAGAGAGCAAGGTGCGGACGG + Intergenic
1036121238 8:6020117-6020139 GAGAGGGAGCAAGAGAGGGAGGG - Intergenic
1036258488 8:7222829-7222851 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036308132 8:7616679-7616701 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1036310543 8:7681425-7681447 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036358988 8:8064680-8064702 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1036416050 8:8549583-8549605 CAGAGAGAGGAAGGAGGGCAGGG + Intergenic
1036499192 8:9297707-9297729 GAGAGGGAGGAAGGGAGGGAGGG + Intergenic
1036546102 8:9771358-9771380 GAGAGAGAGGAAGGGAGGGAGGG + Intronic
1036637937 8:10564430-10564452 GAAAGTGAGCCAGTGGGGGAAGG - Intergenic
1036665393 8:10734065-10734087 AAGAGGGAGGAAGAGGGGGAGGG + Intronic
1037294180 8:17383308-17383330 CAGAGGGAGCAAGAGGAGGAAGG + Intronic
1037497029 8:19450172-19450194 GAGAGTGAGGAAGAGGGAGAGGG + Intronic
1037499281 8:19469913-19469935 CAGAAGGAGAAAGGGAGGGAGGG + Intronic
1037624955 8:20598571-20598593 CAGAGTGAGGAGGGAGGGCATGG - Intergenic
1037724506 8:21472324-21472346 CAGAGGAAGGAAGGGAGGGAAGG + Intergenic
1038052927 8:23830378-23830400 CTGAGGGAGAAAGGGTGGGAAGG - Intergenic
1038278515 8:26141857-26141879 GAGAGGGAGCAAGGGGTGGCGGG - Intergenic
1038488002 8:27950140-27950162 CAGAGCCACCAAGGAGGGGAAGG + Intronic
1038865038 8:31430347-31430369 CAGAGTGTGCAAGGGAGGACAGG + Intergenic
1039182746 8:34884732-34884754 GAGGGAGAGCAAGGGGGAGATGG + Intergenic
1039781302 8:40788959-40788981 GAGAGAGAGGAAGGGAGGGAGGG + Intronic
1039781650 8:40792535-40792557 CAGAGGGAGGGAGGGAGGGAAGG + Intronic
1039805026 8:40990354-40990376 TGGAGTGAGCAGGGGAGGGAAGG + Intergenic
1039812633 8:41063322-41063344 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1039920521 8:41891040-41891062 CAGAGAGAGCAATGGGGTGGGGG + Intronic
1040349463 8:46549684-46549706 GAGAGGGAGGAAGGGGGGGAGGG + Intergenic
1041203452 8:55473885-55473907 CAGAGAGAGGGAGGGAGGGAAGG - Intronic
1041326195 8:56667877-56667899 CAGTGTGAGCAAGAGGTGAAGGG - Intergenic
1041681009 8:60591313-60591335 CAGAGAGAGAGAGGGAGGGAGGG - Intronic
1041859821 8:62500519-62500541 AAGAGTGAGGGAGGGAGGGAGGG + Intronic
1042171931 8:66000079-66000101 CAGAGGGAGGGAGGGAGGGAGGG - Intergenic
1042216844 8:66436430-66436452 CAGAGTGAATAAGGGGGAGATGG + Intronic
1042327966 8:67548119-67548141 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
1042541872 8:69915625-69915647 GAGAGAGAGAAAGGGAGGGAGGG - Intergenic
1043002541 8:74777258-74777280 CAGTGTGAGGAAGGGGTGGGGGG + Intronic
1043238402 8:77899351-77899373 CAGGGTGTGCAATGGGGGTATGG + Intergenic
1043447213 8:80330862-80330884 CACAGTGAGCCTGGGGGTGAAGG + Intergenic
1044518809 8:93173914-93173936 GAGAGAGAGAAAGGGAGGGAGGG - Intergenic
1044693552 8:94901210-94901232 CGTAGTGAGCAAGGGAGTGATGG + Intronic
1044698344 8:94944971-94944993 CAGTTTTAGCAATGGGGGGAGGG - Intronic
1044946841 8:97397326-97397348 CAGAGTGAAGAAGTGAGGGAGGG - Intergenic
1046561440 8:115842753-115842775 CAGAGGAAGGAAGGGAGGGAGGG + Intergenic
1046638166 8:116695743-116695765 GAGACTGAGCAAGGTGGGGAGGG + Intronic
1047135954 8:122078702-122078724 GAGAGTGGGGAAGGGAGGGAGGG + Intergenic
1047190688 8:122676531-122676553 CAGACTGAGCAAGGATGGGGTGG - Intergenic
1047221437 8:122921666-122921688 GAAAGTGAGGAAGGGAGGGAGGG + Intronic
1047490812 8:125373350-125373372 CAGAGAGAACAAGGGAGGGGAGG - Intergenic
1048044043 8:130756594-130756616 GAGAGAGAGAAAGGGAGGGAGGG - Intergenic
1048413156 8:134196994-134197016 CAGAATGTGTAAGGGGAGGATGG - Intergenic
1048959875 8:139567674-139567696 CAGAGTGGGGATGGGGGGGTGGG - Intergenic
1049055510 8:140233536-140233558 GAGAGAGAGGAAGGGAGGGAGGG - Intronic
1049352688 8:142172435-142172457 GGGAGTGAGCAAGGGAGCGAAGG + Intergenic
1049484653 8:142848781-142848803 CAGAGTTTTCAAGGGTGGGATGG + Intronic
1049514393 8:143045702-143045724 CAGAGAGAGGAAGGTGGGGCAGG + Intronic
1049535936 8:143181958-143181980 GAGAGAGAGAAAGGGAGGGAGGG - Intergenic
1049610511 8:143552892-143552914 CAGAGTGGGAAAGGCGGGGAGGG + Intergenic
1050238031 9:3603580-3603602 CAGAGTAAGCAAGGGAGACAGGG + Intergenic
1050672801 9:8016787-8016809 CAGAGGGAGCAAGAGAGAGAAGG + Intergenic
1051350157 9:16191423-16191445 CAGAGGGAGGAAGGCGGGGAGGG + Intergenic
1051500217 9:17768584-17768606 CAGAGTGAACAAGAGGGAGAAGG - Intronic
1053014820 9:34655739-34655761 CAGAGCGGGCAAGGATGGGAGGG - Intronic
1053231008 9:36409196-36409218 GAGAGAGAGAAAGGGAGGGAGGG + Intronic
1053282858 9:36832301-36832323 CAGAGTGTGCAAGGGCAGGCAGG - Intergenic
1053350411 9:37410321-37410343 CAGAGTGAGGGAGGGGGAGAAGG + Intergenic
1053646613 9:40123687-40123709 CACAGTGAGAAAGGGGAAGAGGG + Intergenic
1054254378 9:62799604-62799626 GAGAGAGAGCAAGGTGGAGAGGG + Intergenic
1054336920 9:63815997-63816019 GAGAGAGAGCAAGGTGGAGAGGG - Intergenic
1054537958 9:66252286-66252308 CACAGTGAGAAAGGGGAAGAGGG - Intergenic
1054868862 9:70030833-70030855 GAGAGGGAGGAAGGGAGGGAAGG - Intergenic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1055728998 9:79261522-79261544 CAGTGTGGGCAAGGGAGGGATGG - Intergenic
1056181230 9:84084594-84084616 GAGAGTGAGGGAGGGTGGGAGGG - Intergenic
1056532357 9:87498384-87498406 CCGGGGGAGCAAGGGAGGGAAGG - Intronic
1056994913 9:91446780-91446802 GAGAGAGAGAAAGGGAGGGAGGG - Intergenic
1057026783 9:91740142-91740164 CAGAGAGAGCAAGGGATGTAAGG + Intronic
1057321046 9:94013099-94013121 AAGAGTGAGCAAGAGGGAGAAGG - Intergenic
1057565028 9:96159975-96159997 GAGAGGGAGGAAGGGAGGGAGGG + Intergenic
1057881811 9:98797572-98797594 GAGAGGGAGAAAGGGAGGGAGGG - Intergenic
1058075866 9:100650280-100650302 CAGTGTGAGCATGGGTAGGAAGG + Intergenic
1058189938 9:101901148-101901170 GAGAGTGAGCAAGGTAGGGTAGG + Intergenic
1058201596 9:102048945-102048967 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1058560710 9:106226100-106226122 GAGAGAGAGGAAGGGGGAGATGG - Intergenic
1058721925 9:107772288-107772310 GAGAGAGAGCAAAGGGGGAAGGG + Intergenic
1058959265 9:109977758-109977780 CAGAGAGAGGCAGGGGGTGAAGG - Intronic
1059210558 9:112510992-112511014 CAGAGTGATCAAGCAGGGGATGG + Intronic
1060301474 9:122376895-122376917 CAGATTTAGCAAGGGGGTGGTGG + Intronic
1060786207 9:126453298-126453320 CTGGGTGAGCAAGCAGGGGAGGG + Intronic
1060881972 9:127123693-127123715 CAGAGTAAGAAAGGAGAGGATGG + Intronic
1060978912 9:127781347-127781369 CAGACTGAGGAAGAGGGGCAAGG - Intergenic
1061218859 9:129237308-129237330 CAGAGAGAGGAAGGGAGGAAGGG + Intergenic
1061390600 9:130315306-130315328 CAGAGGGAGGAGGGAGGGGAGGG - Intronic
1061546945 9:131309839-131309861 CAGAGGGAGGAAAGGGGTGAGGG + Intergenic
1062034281 9:134375942-134375964 CAGAGAGAGAGAGGGAGGGAGGG - Intronic
1062070811 9:134554086-134554108 CGGAGTGAGCAGGGGGGTGTGGG + Intergenic
1062237982 9:135521775-135521797 CAGAGTGGGCAGGGCTGGGAGGG + Intronic
1062682498 9:137789245-137789267 CCGAGTGTGCAAGGGCAGGAGGG - Intronic
1062728677 9:138096220-138096242 CACAGAGAGGAAGGGAGGGAGGG + Intronic
1203376853 Un_KI270442v1:383424-383446 GAGAGAGAGCAAGGTGGAGAGGG - Intergenic
1185547812 X:959679-959701 CTGAGTGAGGGAGGGGGGGAAGG - Intergenic
1185847016 X:3447274-3447296 CAGAGTGAGGGAGGGAGGGAGGG - Intergenic
1185907058 X:3944846-3944868 TGGAGGGAGCAAGGAGGGGAGGG - Intergenic
1185932645 X:4219991-4220013 CAGAGAGAGAGAGGGAGGGAGGG + Intergenic
1185966824 X:4614916-4614938 CAGAGAGAGGAGGGGGGAGAGGG + Intergenic
1186269447 X:7869209-7869231 GAGAGTAATCAAGGTGGGGATGG + Intergenic
1186497654 X:10024687-10024709 GAGAGAGAGCATGGGGAGGAGGG + Intronic
1186670698 X:11764738-11764760 CAGAGGGAGAAAGGGAGGGCAGG - Intronic
1186712538 X:12215280-12215302 CAGAGTGAGAGAGAGGAGGAGGG - Intronic
1186860302 X:13666395-13666417 CACAGTGAGCAAGGGGAACAAGG + Intronic
1187208769 X:17208462-17208484 AAGAGGGAGGAAGGGAGGGAAGG + Intergenic
1187460043 X:19478142-19478164 GAGAGGGGGGAAGGGGGGGAGGG + Intronic
1187677225 X:21728202-21728224 GAGAGAGAGAAAGGAGGGGAAGG - Intronic
1187738217 X:22326155-22326177 CAGAGAGAGAAAGGGGGTCAGGG - Intergenic
1188375935 X:29427900-29427922 CAGTCTGAACAAGGAGGGGAAGG + Intronic
1188596234 X:31904546-31904568 CAGTGAGAGAAAGTGGGGGAGGG - Intronic
1189178708 X:38982955-38982977 GAGAGTGAGCAAAGGAAGGAGGG + Intergenic
1189253530 X:39619954-39619976 CAGAGGGAACAAGGGGAGTAGGG + Intergenic
1189321652 X:40090737-40090759 GAGAGAGAGCAAGGCGGGAAGGG + Intronic
1189715496 X:43860785-43860807 TAGAATGAGCAAGGGGTGGTAGG - Intronic
1190097484 X:47493283-47493305 TAGAGTGAGGAATGGGGGAAGGG + Intergenic
1190280706 X:48927586-48927608 CAGAGTGAGATATGGGGGAAGGG + Intronic
1190338382 X:49277141-49277163 CAGAGTAAGCGAGCGGGTGAGGG - Intronic
1190427205 X:50345056-50345078 GAGAGTGAGGCAGGGAGGGAGGG - Intronic
1190886725 X:54536800-54536822 CAGAGAGAGAGAGGGAGGGAGGG + Intronic
1190942567 X:55056542-55056564 CAGAGTGGGCAATTGTGGGAGGG + Intergenic
1193189098 X:78548524-78548546 AAGAGAGAGCAAGAGGGAGAGGG - Intergenic
1194535622 X:95103204-95103226 CAGGGTGAGCAATGGGGGCATGG + Intergenic
1195236411 X:102903268-102903290 GAGAGAGAGAAAGGGAGGGAGGG + Intergenic
1195460335 X:105116225-105116247 GAGAGTGAGCAAGGGCTGCAAGG + Intronic
1195640918 X:107174081-107174103 GAGAGAGAGAAAGGGAGGGAGGG - Intronic
1195702931 X:107718274-107718296 CAGAAGGAGCAAGAGGGGCAGGG + Intronic
1196681710 X:118476150-118476172 GTGAGTGAGCAAGGGGAGAATGG + Intergenic
1197749993 X:129957605-129957627 CAGAGGGAGGGAGCGGGGGAAGG - Intergenic
1197800000 X:130339008-130339030 GAGAGAAAGGAAGGGGGGGAGGG - Intergenic
1198700347 X:139390823-139390845 CAGAGTGAGCAAGAGTTTGAGGG + Intergenic
1199296485 X:146164650-146164672 CAGAGGGAGGGAGGGAGGGAGGG + Intergenic
1199417241 X:147599497-147599519 CAGAGAGAGGGAGGGAGGGATGG - Intergenic
1199439171 X:147848957-147848979 CAGAGTCAGCTGGGTGGGGATGG - Intergenic
1199865221 X:151841207-151841229 CAGAATGGGGAAGGGTGGGAGGG + Intergenic
1200047093 X:153408935-153408957 GTGAGTGAGCAAGTTGGGGAAGG - Intergenic
1200132823 X:153860657-153860679 CAGAGAGAGAGAGGGAGGGAGGG - Intergenic
1200791717 Y:7305181-7305203 CAAGGGGAGCAAGGGTGGGAGGG - Intergenic
1201146045 Y:11066317-11066339 GGGAAGGAGCAAGGGGGGGAGGG + Intergenic
1201146259 Y:11067003-11067025 GAGAGGGAGGAAGGGAGGGAAGG + Intergenic
1201146276 Y:11067056-11067078 GAGAGGGAGGAAGGGAGGGAAGG + Intergenic
1201146330 Y:11067206-11067228 CAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1201146340 Y:11067246-11067268 GAGAGAGAGGAAGGGAGGGAAGG + Intergenic
1201146361 Y:11067318-11067340 GAGAGGGAGGAAGGGAGGGAAGG + Intergenic
1201146556 Y:11067940-11067962 GAGAGGGAGGAAGGGAGGGAAGG + Intergenic
1201681324 Y:16646993-16647015 AAGAGAGAGGAAGGGAGGGAGGG - Intergenic
1201741240 Y:17326273-17326295 GAGAGAGAGCGAGGGAGGGAGGG + Intergenic