ID: 1142282751

View in Genome Browser
Species Human (GRCh38)
Location 16:89157049-89157071
Sequence GGCCCTTCTAGCCCTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142282742_1142282751 30 Left 1142282742 16:89156996-89157018 CCTGCTCTGCCTCAGTTTCCCTA No data
Right 1142282751 16:89157049-89157071 GGCCCTTCTAGCCCTGGCCAAGG No data
1142282743_1142282751 21 Left 1142282743 16:89157005-89157027 CCTCAGTTTCCCTACTCTGTGAA No data
Right 1142282751 16:89157049-89157071 GGCCCTTCTAGCCCTGGCCAAGG No data
1142282746_1142282751 11 Left 1142282746 16:89157015-89157037 CCTACTCTGTGAACTGCGGCTGC No data
Right 1142282751 16:89157049-89157071 GGCCCTTCTAGCCCTGGCCAAGG No data
1142282745_1142282751 12 Left 1142282745 16:89157014-89157036 CCCTACTCTGTGAACTGCGGCTG No data
Right 1142282751 16:89157049-89157071 GGCCCTTCTAGCCCTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142282751 Original CRISPR GGCCCTTCTAGCCCTGGCCA AGG Intergenic
No off target data available for this crispr