ID: 1142284779

View in Genome Browser
Species Human (GRCh38)
Location 16:89167315-89167337
Sequence CTGAGCACTGGGAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142284779_1142284791 -10 Left 1142284779 16:89167315-89167337 CCCCCCACCTTCCCAGTGCTCAG No data
Right 1142284791 16:89167328-89167350 CAGTGCTCAGGGCCAGGGAAAGG No data
1142284779_1142284799 27 Left 1142284779 16:89167315-89167337 CCCCCCACCTTCCCAGTGCTCAG No data
Right 1142284799 16:89167365-89167387 CCACACTTGCAGCCCCCCCCTGG No data
1142284779_1142284795 -2 Left 1142284779 16:89167315-89167337 CCCCCCACCTTCCCAGTGCTCAG No data
Right 1142284795 16:89167336-89167358 AGGGCCAGGGAAAGGGTGGTGGG No data
1142284779_1142284794 -3 Left 1142284779 16:89167315-89167337 CCCCCCACCTTCCCAGTGCTCAG No data
Right 1142284794 16:89167335-89167357 CAGGGCCAGGGAAAGGGTGGTGG No data
1142284779_1142284797 3 Left 1142284779 16:89167315-89167337 CCCCCCACCTTCCCAGTGCTCAG No data
Right 1142284797 16:89167341-89167363 CAGGGAAAGGGTGGTGGGCATGG No data
1142284779_1142284792 -9 Left 1142284779 16:89167315-89167337 CCCCCCACCTTCCCAGTGCTCAG No data
Right 1142284792 16:89167329-89167351 AGTGCTCAGGGCCAGGGAAAGGG No data
1142284779_1142284800 28 Left 1142284779 16:89167315-89167337 CCCCCCACCTTCCCAGTGCTCAG No data
Right 1142284800 16:89167366-89167388 CACACTTGCAGCCCCCCCCTGGG No data
1142284779_1142284801 29 Left 1142284779 16:89167315-89167337 CCCCCCACCTTCCCAGTGCTCAG No data
Right 1142284801 16:89167367-89167389 ACACTTGCAGCCCCCCCCTGGGG No data
1142284779_1142284793 -6 Left 1142284779 16:89167315-89167337 CCCCCCACCTTCCCAGTGCTCAG No data
Right 1142284793 16:89167332-89167354 GCTCAGGGCCAGGGAAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142284779 Original CRISPR CTGAGCACTGGGAAGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr