ID: 1142296525

View in Genome Browser
Species Human (GRCh38)
Location 16:89226765-89226787
Sequence GAGTTCTCACGTGTGTGCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142296525_1142296528 19 Left 1142296525 16:89226765-89226787 CCTCAGCACACACGTGAGAACTC 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1142296528 16:89226807-89226829 TGTGTCTAATCATTATGAAAGGG 0: 1
1: 0
2: 0
3: 17
4: 245
1142296525_1142296527 18 Left 1142296525 16:89226765-89226787 CCTCAGCACACACGTGAGAACTC 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1142296527 16:89226806-89226828 GTGTGTCTAATCATTATGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142296525 Original CRISPR GAGTTCTCACGTGTGTGCTG AGG (reversed) Exonic
904615270 1:31746166-31746188 GGGTCCTCACGTGAGTCCTGGGG - Intronic
905205568 1:36341087-36341109 GGGAGCTCACGTGTGGGCTGTGG + Exonic
905508333 1:38498531-38498553 GAGATCCCGCCTGTGTGCTGGGG + Intergenic
905971647 1:42146341-42146363 GAGTGCTCTCGTGTGTGTAGGGG - Intergenic
906479205 1:46189264-46189286 GAGGTCTCATGTCTGTTCTGGGG + Exonic
906754563 1:48297712-48297734 GGCTTCACAGGTGTGTGCTGGGG + Exonic
907668466 1:56453300-56453322 GAGCTCACATGTGTGTGTTGAGG - Intergenic
909063705 1:70907739-70907761 GAGGTCTCAGGTGTGAACTGAGG - Intronic
916491803 1:165308823-165308845 GACTTCTCAAGTGTCTTCTGAGG - Intronic
918434827 1:184500612-184500634 GACTTCCCAGCTGTGTGCTGTGG - Intronic
919074499 1:192797362-192797384 GAGCTCCCTCATGTGTGCTGAGG - Intergenic
921065115 1:211617069-211617091 GATTTCTGATGTGTGTGGTGAGG + Intergenic
921245982 1:213241156-213241178 GAGCTCTCAGCTGTGTGCTGGGG - Exonic
922082703 1:222312387-222312409 GAATACTCAAGTTTGTGCTGTGG - Intergenic
922787350 1:228289571-228289593 GTGTCCTCACGTGTGGGCGGTGG + Intronic
924330906 1:242939540-242939562 GAGTTCTCATGTGTATGAAGAGG + Intergenic
1064346262 10:14535353-14535375 GAGTTCTCATGTTTGTGCCAGGG - Intronic
1064351743 10:14583417-14583439 GAGTTCTGTGGTCTGTGCTGCGG - Intronic
1068635934 10:59348225-59348247 GAGTTCTAATGAGTGTGCTATGG - Intronic
1069896732 10:71684735-71684757 GAGTTCCCATGAGTGGGCTGAGG + Intronic
1071669215 10:87591654-87591676 GAGTTCTGATCTGTGTGCTTTGG - Intergenic
1071734631 10:88284569-88284591 GGGTTCTCCAGTATGTGCTGTGG - Intronic
1075296725 10:121283585-121283607 GGGTTCTCAGGTGTGTGGTTAGG - Intergenic
1076594996 10:131619785-131619807 GTGTTCTAAGGTGTGTCCTGTGG + Intergenic
1076685927 10:132198500-132198522 GAGTTGGCTCGGGTGTGCTGTGG - Intronic
1081219701 11:40445442-40445464 GAGTTCTCTGATGTCTGCTGAGG + Intronic
1082901956 11:58264942-58264964 GACATCCCACGTGTGTCCTGTGG - Intergenic
1089158437 11:116419961-116419983 GAGATCCCACCTGTGGGCTGAGG - Intergenic
1089584564 11:119502283-119502305 GAGTTCTGGTGCGTGTGCTGGGG + Intergenic
1096994048 12:55828093-55828115 GATTTTTCACGTGTGTCCAGCGG - Exonic
1103323409 12:120104542-120104564 ACTTTCTCTCGTGTGTGCTGGGG + Intronic
1104573588 12:129946319-129946341 GAACTCTCCCATGTGTGCTGAGG + Intergenic
1104752111 12:131246284-131246306 GAGGTGTCAGGGGTGTGCTGAGG + Intergenic
1104779231 12:131409133-131409155 GAGGCATCAAGTGTGTGCTGAGG - Intergenic
1104886907 12:132115781-132115803 CACTTCTCAAGTGTGTTCTGGGG + Intronic
1105024613 12:132839715-132839737 GAGTTTGCACGTTTGTGCAGGGG - Intronic
1105463091 13:20609854-20609876 GAGTGCTCAGGTCTGAGCTGAGG + Intronic
1112784328 13:102935193-102935215 AAGTCCTCAGGTGTGTGCTTGGG + Intergenic
1113492996 13:110706565-110706587 GGGTGCTGACGTGTGTTCTGGGG - Intronic
1116632824 14:47356173-47356195 AGGTTCACAAGTGTGTGCTGGGG - Intronic
1117335850 14:54756695-54756717 GAGATATCACATGAGTGCTGAGG + Intronic
1118337463 14:64866311-64866333 GAGCTCTTACGGGTGTCCTGAGG - Intronic
1123471211 15:20553943-20553965 GAGTTGTCCCGTGTGTCTTGGGG - Intergenic
1123646848 15:22446758-22446780 GAGTTGTCCCGTGTGTCTTGGGG + Intergenic
1123731511 15:23148937-23148959 GAGTTGTCCCGTGTGTCTTGGGG - Intergenic
1123749648 15:23346349-23346371 GAGTTGTCCCGTGTGTCTTGGGG - Intergenic
1124130192 15:26976864-26976886 GGGTTTTCACGTGTGTGGTTGGG + Intronic
1124291604 15:28457098-28457120 CAGACCTCAGGTGTGTGCTGGGG + Intergenic
1124554173 15:30709811-30709833 GAGGTCTCTGGTGTTTGCTGAGG - Intronic
1124677072 15:31695860-31695882 GAGGTCTCTGGTGTTTGCTGAGG + Intronic
1126994611 15:54426527-54426549 GAGTTCTCACTTCTGTGATTGGG - Intronic
1127654462 15:61043340-61043362 GAGTTCTCATCTGTGAGATGAGG - Intronic
1130515172 15:84620903-84620925 GGGTCCTCTCGTGTGTGATGAGG - Exonic
1132673814 16:1113582-1113604 GATTCCTCATCTGTGTGCTGAGG - Intergenic
1132764120 16:1525810-1525832 GAGGCCTCTTGTGTGTGCTGTGG - Intronic
1132942065 16:2513400-2513422 GACTTCACAGGTGTGGGCTGGGG + Intronic
1133533900 16:6681773-6681795 CAGTTCTCACGTCTGTAATGTGG + Intronic
1134182819 16:12061435-12061457 TAGTTCTCAGGAGGGTGCTGTGG + Intronic
1135046215 16:19158053-19158075 GAGCCCTCATGTGTGTGCAGGGG + Intronic
1135474261 16:22760476-22760498 GTGTTCTCACGTGGGAGCTGTGG - Intergenic
1136516526 16:30771964-30771986 GAGGGCTCAGGTGTGTGCAGGGG + Exonic
1136707177 16:32200572-32200594 GAGACCTCAGGTGTGTGCTGGGG - Intergenic
1136760733 16:32728845-32728867 GAGACCTCAGGTGTGTGCTGGGG + Intergenic
1136807370 16:33141541-33141563 GAGACCTCAGGTGTGTGCTGGGG - Intergenic
1137673874 16:50294290-50294312 GAGTTCTGAAGTCTGTGCTGTGG + Intronic
1138707524 16:58932632-58932654 GAGTTCTCATCTGTATGATGAGG + Intergenic
1139110651 16:63886589-63886611 GAGCTCTCAGTTTTGTGCTGTGG - Intergenic
1141630011 16:85282457-85282479 GAGTTCTCATGTGTGTTTTGGGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1142239846 16:88940223-88940245 GCGTCCGCCCGTGTGTGCTGGGG - Exonic
1142296525 16:89226765-89226787 GAGTTCTCACGTGTGTGCTGAGG - Exonic
1203062885 16_KI270728v1_random:989159-989181 GAGACCTCAGGTGTGTGCTGGGG + Intergenic
1142836028 17:2587440-2587462 GGGCACCCACGTGTGTGCTGAGG - Intergenic
1143097995 17:4488780-4488802 GAGTTTCCACTTGGGTGCTGGGG + Intergenic
1147426770 17:40349525-40349547 GAGGAGTCAGGTGTGTGCTGTGG + Intronic
1147742895 17:42678799-42678821 TAGTTATCACGGGTGTGGTGGGG - Intergenic
1150593002 17:66579536-66579558 CAGTTTTCACATGTGTGCAGTGG - Intronic
1152397509 17:80043324-80043346 AAGTTATCACTTGGGTGCTGGGG + Intronic
1152738287 17:82008082-82008104 GAGGTCTCAGGTGTGTCCGGAGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1153842269 18:9017496-9017518 GAGCTCTCACATGCGTGCGGTGG - Intergenic
1153954865 18:10087618-10087640 TAGTACCCACGCGTGTGCTGTGG + Intergenic
1155061119 18:22229466-22229488 AAGTTCTGGCGTGTGGGCTGAGG + Intergenic
1162219158 19:9161361-9161383 GAGTTTTCACGTGGCTCCTGAGG - Exonic
1162243709 19:9380901-9380923 GAGTTCTTAAGTGTTTCCTGAGG - Exonic
1162243784 19:9381645-9381667 GAGTTCTCACGTGTACCCTCAGG - Exonic
1162247520 19:9414627-9414649 GAGTTCTCACATGTGTCTTAAGG + Exonic
1162260457 19:9529543-9529565 GAGTTCTCACGTGCGTCTTAAGG + Exonic
1163056017 19:14718719-14718741 GAGTTCTCACGTGGCTCCTGAGG - Exonic
1164592844 19:29515622-29515644 GAGCTCTCACTTCTTTGCTGTGG - Intergenic
1165506736 19:36236782-36236804 GAGTTCTCTGGTGTCTGATGAGG - Exonic
1167007323 19:46784492-46784514 GAGTCCTCAGGGGTGTCCTGAGG - Intronic
1167072507 19:47228874-47228896 GAGTCCTTGTGTGTGTGCTGTGG - Intronic
925542930 2:4985569-4985591 GCGTGCTCACGTGTGTGTTTTGG - Intergenic
927739081 2:25550935-25550957 GAGGTCTCAGCTGGGTGCTGTGG - Intronic
927909072 2:26883914-26883936 GAGACCTCAGGTGTGGGCTGGGG - Intronic
928641840 2:33307171-33307193 GAGTTCTCATATGTTTCCTGTGG + Intronic
933032396 2:77346460-77346482 GTGTACACATGTGTGTGCTGGGG + Intronic
935418003 2:102838699-102838721 CAGTTCAGACGTGTGTTCTGGGG + Intronic
938623556 2:133083386-133083408 GAGTAATCAGGGGTGTGCTGGGG + Intronic
944225374 2:197344171-197344193 GAAATCTCACGTGGCTGCTGTGG - Intergenic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
1169039846 20:2484006-2484028 GTGTTCTCTGGTGTCTGCTGAGG + Exonic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1176046189 20:63094033-63094055 GAGAGCTCACGTGTGTGCACAGG - Intergenic
1181566908 22:23744405-23744427 GAATTCTCTCGTGTTTTCTGAGG + Exonic
950485990 3:13274251-13274273 GACTTCTCACCTGAGCGCTGAGG + Intergenic
951486573 3:23219087-23219109 AAATTCTCACTTGTGGGCTGAGG + Intronic
954860039 3:53680299-53680321 GAGCTCTCACTTGTCAGCTGTGG + Intronic
954874770 3:53794877-53794899 CAGTTCTCAGGTGTGTTCTGGGG - Intronic
957091776 3:75737618-75737640 GAGTTCTCTGGTGTATGGTGAGG + Intronic
967873320 3:194249890-194249912 TGGTTCTCACCTGTGTGTTGTGG - Intergenic
969574714 4:8030166-8030188 GGTTTCTCACGTGTGAACTGGGG + Intronic
979725282 4:123953768-123953790 GAGTGACCACATGTGTGCTGGGG + Intergenic
982601273 4:157453304-157453326 GTGTGCTCACGAGTGTACTGGGG + Intergenic
986698314 5:10377374-10377396 GAGTCCTCACATGTGTTTTGTGG + Intronic
987401816 5:17485915-17485937 GACTTCTGACCTGTGAGCTGGGG + Intergenic
995156423 5:108918877-108918899 GAGTTCTCAATTGTATTCTGAGG + Intronic
997249725 5:132379312-132379334 GTGTTCTCACATGTGTCATGTGG - Intronic
998437303 5:142122943-142122965 GAGTTCTCGTGTGTGTGTTTTGG + Intronic
1002342701 5:178527281-178527303 GAGCTCTCCCTTCTGTGCTGGGG + Intronic
1006458322 6:34144347-34144369 GTGTACGCGCGTGTGTGCTGGGG - Intronic
1007694493 6:43723784-43723806 GAGTTCTGAGGCCTGTGCTGGGG - Intergenic
1007881528 6:45173091-45173113 GAGTTCTTAAGTGTGTGATCAGG - Intronic
1008677496 6:53835795-53835817 CAGTTTTCATGTGTGTTCTGTGG + Intronic
1013294471 6:108746537-108746559 GACTTCTCCCAGGTGTGCTGTGG - Intergenic
1013573673 6:111456313-111456335 CTGTTCTCAAGTATGTGCTGGGG + Intronic
1016288211 6:142497816-142497838 GATTTCTCAAGTGTGATCTGTGG + Intergenic
1017329440 6:153178396-153178418 GAGTTCTCAGGTGTTTGCCAGGG + Intergenic
1018786418 6:167111743-167111765 GTGATCTGAAGTGTGTGCTGAGG + Intergenic
1018901048 6:168051885-168051907 GAGTGCCCACCTGTGGGCTGGGG - Intergenic
1019499379 7:1357025-1357047 GATTTATCTAGTGTGTGCTGAGG - Intergenic
1019499391 7:1357201-1357223 GATTTATCTAGTGTGTGCTGAGG - Intergenic
1019499397 7:1357289-1357311 GATTTATCTAGTGTGTGCTGAGG - Intergenic
1019499414 7:1357531-1357553 GATTTATCTAGTGTGTGCTGAGG - Intergenic
1019745689 7:2699476-2699498 GGGCCCTCACGTGTGTCCTGGGG + Intronic
1023710091 7:42982849-42982871 GAGTAATCAGGTGTGAGCTGTGG + Intergenic
1027654431 7:80912684-80912706 TAGTTCTCAGGTGTGTGTTATGG - Intronic
1031669463 7:124525134-124525156 GGGTGCACACGTGTTTGCTGTGG + Intergenic
1035732471 8:1862594-1862616 GAGGGCTCATGTGTGTGCTCTGG + Intronic
1036711323 8:11080895-11080917 CAGTTTTCACGTGTGTACAGTGG - Intronic
1039711731 8:40061990-40062012 GAATGCTCAGGTGTGAGCTGTGG - Intergenic
1040155410 8:44184472-44184494 GAGTAATCACGTTTGTGATGTGG + Intergenic
1042993478 8:74667032-74667054 GACTGCTCACGTGACTGCTGAGG + Intronic
1044320155 8:90792086-90792108 TAGTTCTCGCCTGTGTTCTGGGG - Intronic
1046654669 8:116880319-116880341 GAGTTTTAACGTTTGAGCTGAGG + Intergenic
1048303857 8:133269962-133269984 GACGTCTCATGTCTGTGCTGAGG - Intronic
1048770105 8:137886038-137886060 GAGGACTCAGTTGTGTGCTGTGG + Intergenic
1053159889 9:35806597-35806619 GAGTTCTCAGGTGCCTGATGAGG - Intronic
1056723155 9:89088846-89088868 GGGTTCTCCCCTGGGTGCTGTGG - Intronic
1189193830 X:39134966-39134988 GAGTTACCAGGTGTGTGTTGAGG - Intergenic
1196365946 X:114924596-114924618 GAGCTCTGACATCTGTGCTGAGG + Intergenic
1197871673 X:131067727-131067749 ATGTTCTCATGTGTGTGGTGTGG - Intronic
1200117257 X:153774797-153774819 GAGTTCACAGGTGGGTGCGGAGG + Exonic