ID: 1142303941

View in Genome Browser
Species Human (GRCh38)
Location 16:89275162-89275184
Sequence GGGCTCCGCCAGGGAGGGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 2, 1: 2, 2: 11, 3: 50, 4: 527}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142303929_1142303941 2 Left 1142303929 16:89275137-89275159 CCTGCTGCCTGAACAGCTCCTTC 0: 2
1: 1
2: 6
3: 42
4: 381
Right 1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG 0: 2
1: 2
2: 11
3: 50
4: 527
1142303927_1142303941 13 Left 1142303927 16:89275126-89275148 CCGGACGGCCTCCTGCTGCCTGA 0: 2
1: 0
2: 5
3: 8
4: 249
Right 1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG 0: 2
1: 2
2: 11
3: 50
4: 527
1142303926_1142303941 14 Left 1142303926 16:89275125-89275147 CCCGGACGGCCTCCTGCTGCCTG 0: 2
1: 0
2: 5
3: 30
4: 361
Right 1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG 0: 2
1: 2
2: 11
3: 50
4: 527
1142303928_1142303941 5 Left 1142303928 16:89275134-89275156 CCTCCTGCTGCCTGAACAGCTCC 0: 2
1: 0
2: 6
3: 50
4: 475
Right 1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG 0: 2
1: 2
2: 11
3: 50
4: 527
1142303925_1142303941 15 Left 1142303925 16:89275124-89275146 CCCCGGACGGCCTCCTGCTGCCT 0: 2
1: 0
2: 3
3: 25
4: 213
Right 1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG 0: 2
1: 2
2: 11
3: 50
4: 527
1142303933_1142303941 -5 Left 1142303933 16:89275144-89275166 CCTGAACAGCTCCTTCAGGGGCT 0: 2
1: 0
2: 1
3: 24
4: 181
Right 1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG 0: 2
1: 2
2: 11
3: 50
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142303941 Original CRISPR GGGCTCCGCCAGGGAGGGAG GGG Exonic
900132162 1:1091784-1091806 GGGCTGTGGCAGGGAGGGTGGGG + Intronic
900148342 1:1167830-1167852 GGGTCCCGCCAGGCAGGCAGGGG - Intergenic
900227099 1:1538411-1538433 GGGCTCCGCGGGGCAGGCAGAGG - Intronic
900422396 1:2561209-2561231 TGGCTGCCCCAGGGAGGGGGCGG + Intronic
900515316 1:3079122-3079144 CGGCTCCACCAGGGAGGCGGTGG - Intronic
900557145 1:3286361-3286383 GGGCTCTGCCAGGCAGGGGGCGG - Intronic
900589945 1:3454980-3455002 GGGCTCCGCCGGGGCGGGAGAGG + Intronic
900797798 1:4719828-4719850 GGACACCGGCAGGGAGGGAAGGG - Intronic
900866995 1:5275835-5275857 GGACTTCTCCAGGGAGGGTGGGG + Intergenic
900971890 1:5996394-5996416 GGGCACCCTCAGGCAGGGAGGGG - Intronic
901004617 1:6165797-6165819 AGGCTCCCCCAGGGAAGGAGAGG - Intronic
901202259 1:7473405-7473427 GGGCTCCCCCAAGGAGGAGGAGG + Intronic
902290021 1:15429389-15429411 GGGCCCAGCCAGGCAGGGTGTGG + Exonic
902388206 1:16088122-16088144 GGGCACCTCCTGGGAGGAAGAGG + Intergenic
902554209 1:17237465-17237487 TGGCTCAGGCAGGGAAGGAGGGG - Intronic
902605307 1:17565851-17565873 GGAGGCAGCCAGGGAGGGAGGGG - Intronic
903154733 1:21435982-21436004 GTGGTGGGCCAGGGAGGGAGGGG + Intergenic
903319983 1:22537224-22537246 GCGCACAGCCAGGGAGTGAGGGG - Intergenic
903526505 1:23995003-23995025 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
903648470 1:24909036-24909058 GGGCTCTGGCAGATAGGGAGTGG - Intronic
903713939 1:25348957-25348979 GGGCTCAGGCAGGGTGGGAAGGG + Intronic
903923414 1:26817409-26817431 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
904434608 1:30486054-30486076 GGGACCCTCCAGGGAGGGTGTGG + Intergenic
904495197 1:30882547-30882569 GGGGTGCTCCTGGGAGGGAGGGG - Intronic
904498775 1:30902334-30902356 GGGCTTGGCCAGTGGGGGAGGGG + Intronic
904794815 1:33051279-33051301 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
905013226 1:34760766-34760788 GGGCTGGGCCAGGGCAGGAGGGG - Intronic
905402844 1:37716057-37716079 GAGCTCACCCTGGGAGGGAGGGG - Exonic
906436919 1:45804005-45804027 GAGCGCCGCCCGGGAGGCAGCGG + Exonic
906486645 1:46240440-46240462 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
907385261 1:54121765-54121787 GGCCTCTGCCAGAGAGGCAGGGG + Intergenic
907445018 1:54501933-54501955 GGGCCCAGCAAGGCAGGGAGTGG - Intergenic
907453926 1:54563103-54563125 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
908051355 1:60235088-60235110 GGGTTCTGCCAGGGAGAGATTGG - Intergenic
908477674 1:64505623-64505645 GGGTTCGCCCAGGGAGGGGGAGG - Intronic
910200072 1:84690314-84690336 GCGCCCCGCCAGGGAGGGGCGGG - Intronic
911725408 1:101236957-101236979 GTGCTCCGCTGCGGAGGGAGGGG + Exonic
912433721 1:109643798-109643820 GGGCTGGGCCAGCGCGGGAGAGG + Intergenic
912481343 1:109984378-109984400 GGGCTGGGCCAGTGAGTGAGTGG + Intergenic
912624497 1:111196204-111196226 AGCCTCTGCCAGGGAGGGAGAGG - Intronic
912825489 1:112899353-112899375 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
912844655 1:113068752-113068774 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
913047924 1:115089494-115089516 AGGCTCCGGCGGGGAGGGGGCGG + Intronic
913671116 1:121097875-121097897 CGGCGGCGGCAGGGAGGGAGCGG + Intergenic
914022883 1:143885296-143885318 CGGCGGCGGCAGGGAGGGAGCGG + Intergenic
914197390 1:145454547-145454569 CGGCCCCGGCAGGGAGGGCGCGG + Intergenic
914661370 1:149793240-149793262 CGGCGGCGGCAGGGAGGGAGCGG + Intronic
914753429 1:150550333-150550355 GGGCTGCGCAGGGGAGGGTGGGG + Intronic
914813171 1:151044524-151044546 GGCTTGAGCCAGGGAGGGAGAGG - Intronic
914864371 1:151414148-151414170 GGGCTCAGCCAGCCAGAGAGAGG + Intronic
915943046 1:160130813-160130835 GAGCTGTGCCAGGGAGGGAGAGG - Intronic
919993550 1:202726953-202726975 GTTCTCATCCAGGGAGGGAGTGG + Exonic
920029263 1:203026795-203026817 GGGCACCGCAAAGGAGGGCGAGG - Intronic
921004993 1:211084545-211084567 GGGCTAGGCCAGAGAGTGAGGGG - Intronic
921341732 1:214140692-214140714 GGTTTCCGCCAGGGAATGAGTGG - Intergenic
921360751 1:214329313-214329335 GGGCACCACCAGGCAGGCAGGGG - Intronic
921414451 1:214870459-214870481 GAGCACCGCCCGGGAGGCAGCGG - Intergenic
922675465 1:227546611-227546633 GGGCACCCCCAGGGGGTGAGGGG + Intergenic
923126767 1:231040271-231040293 GGGCACCGCCGGGAAGGGGGCGG - Intergenic
924511477 1:244731835-244731857 GGGCACAGCCCTGGAGGGAGGGG + Intergenic
1062993975 10:1847575-1847597 GGGCTCCGCCAGGGTGGGAGTGG + Intergenic
1063388895 10:5635787-5635809 GTGGTCTTCCAGGGAGGGAGTGG - Intergenic
1065816959 10:29491255-29491277 GGTCTCCTCCTGGGAGGGTGTGG + Intronic
1065955887 10:30693238-30693260 GGTCTCCTCCTGGGAGGGTGTGG - Intergenic
1065972761 10:30818330-30818352 GGGACCCGCCAGAGAGGGCGAGG - Intergenic
1067937500 10:50624073-50624095 GGGCTCCTCCCGGGACCGAGCGG + Intronic
1068783156 10:60943652-60943674 TGGCTGCGCCAGGGAGGGGGTGG - Intronic
1069574651 10:69517771-69517793 GGGCTCTGCCAGGGTTTGAGGGG + Intergenic
1069631079 10:69897357-69897379 TGGCTTCCCCAGGGAGGGAGAGG + Intronic
1069680905 10:70284264-70284286 GGGCTTCGGGAGGGAGGCAGGGG + Intergenic
1069993493 10:72328974-72328996 GGGCTCCACGGTGGAGGGAGGGG + Intergenic
1070833959 10:79436458-79436480 GGGCTACGCTGGGGTGGGAGAGG - Intronic
1070934877 10:80285478-80285500 GGTCTCCAGCAGGGAGGGATCGG + Intronic
1072914183 10:99527058-99527080 GGGCTCCGTCAGAGAGGAAGGGG + Intergenic
1072950131 10:99840162-99840184 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1074149027 10:110741816-110741838 GGGCTCTCCTGGGGAGGGAGGGG - Intronic
1074769117 10:116722085-116722107 GGCCTGCGCCTGGGAGGGACAGG - Intronic
1075519626 10:123136012-123136034 GGTCCCCGGGAGGGAGGGAGCGG - Exonic
1075768971 10:124917314-124917336 GGGCGCCGCCTGGGAGCGAGGGG - Intergenic
1076365003 10:129916053-129916075 GGGCTCCGAGGGGGAAGGAGAGG + Intronic
1076733276 10:132448624-132448646 GGGCTGGGCAAGGGTGGGAGGGG - Exonic
1076733480 10:132449087-132449109 GGGCTGGGCAAGGGTGGGAGGGG - Exonic
1076805874 10:132858486-132858508 AGGCTTTGCCAGGGTGGGAGTGG + Intronic
1076919935 10:133446181-133446203 GGGCTCCGCCAGGGCAGGGCTGG - Intergenic
1077009715 11:374679-374701 GGCCTCAGGGAGGGAGGGAGGGG + Intronic
1077142463 11:1030584-1030606 GGGCTCCGCCAGCGGCGGACCGG + Exonic
1077197275 11:1287782-1287804 AGGCTGCGGCAGGGAGGGTGCGG - Intronic
1077252379 11:1566385-1566407 GGGCTGTGCTAGGGAGAGAGGGG - Intronic
1077297376 11:1832487-1832509 AGGCTCAGGCAGGGAGGGCGGGG + Intronic
1077413377 11:2413705-2413727 GGGCTCCGGGAGGGAGGGCTGGG - Intronic
1077418391 11:2436562-2436584 GGGCCCCGCCAGGGCTGGGGAGG + Intergenic
1077419623 11:2444430-2444452 CAGCTGCGCCAGGGAGGAAGGGG - Intergenic
1077424333 11:2467284-2467306 GGTGTCCGGCAGGGAGGCAGGGG + Intronic
1077453189 11:2663083-2663105 GGCCACCTCCAGGGAAGGAGTGG + Intronic
1077503591 11:2920103-2920125 GGGACCCGCCAGGGTGGGGGTGG + Intronic
1077539127 11:3138419-3138441 GGGGTCAGCCGGGGAGGGAGGGG + Intronic
1077677771 11:4212213-4212235 GGGCTGCGGCAGGGAGGGAGAGG + Intergenic
1078246088 11:9574114-9574136 GGGCTCCGCGCGGGCGGCAGCGG - Exonic
1080443696 11:32318082-32318104 GTGCCCTGCCAGGGAGAGAGGGG - Intergenic
1081784960 11:45739211-45739233 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1081831960 11:46121654-46121676 GGGCCGCGGCGGGGAGGGAGGGG + Intergenic
1082023332 11:47552944-47552966 GGGCCGCGGGAGGGAGGGAGGGG - Intronic
1083151268 11:60793270-60793292 GGGCTCAGCCCAGGAGGGTGAGG - Intronic
1083628993 11:64086177-64086199 GGGATCCCCCAGGGCTGGAGTGG + Intronic
1083843026 11:65315354-65315376 GGGCTCCGCCCGGGTAGGAGTGG + Intronic
1083895155 11:65616174-65616196 GGCCTCCCCCAGCGGGGGAGGGG - Exonic
1084010931 11:66347844-66347866 GCGCGCCGGCGGGGAGGGAGAGG - Intergenic
1084434696 11:69132054-69132076 GGGTTACAGCAGGGAGGGAGGGG - Intergenic
1084459538 11:69288755-69288777 GAGCTGGGCCAGGGAGGGCGGGG - Intergenic
1084547639 11:69822328-69822350 TGGCTCCGAATGGGAGGGAGAGG - Intergenic
1085020144 11:73201551-73201573 AGCCTCCGCCAGGAGGGGAGCGG - Intergenic
1087117101 11:94537254-94537276 GGGCTGGGGGAGGGAGGGAGGGG - Intergenic
1089065433 11:115659105-115659127 GCGCTCCGCAAGGGAGCCAGGGG + Intergenic
1089366386 11:117923411-117923433 GGGCCCAGCCAGTGAGAGAGGGG + Intronic
1089650711 11:119910946-119910968 TGGCTTTGCCAGGGAGGGATGGG + Intergenic
1089925128 11:122249102-122249124 GAGCTCACCCAGGGAGAGAGTGG + Intergenic
1091709451 12:2727680-2727702 GGGCTACTAGAGGGAGGGAGTGG - Intergenic
1091762449 12:3096032-3096054 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1092239491 12:6828384-6828406 GGGAGCCGAGAGGGAGGGAGAGG - Intronic
1092961908 12:13604012-13604034 GAGCTTGGCCAGTGAGGGAGGGG - Intronic
1095439338 12:42227138-42227160 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1095672400 12:44876346-44876368 CTGCTCCTCCGGGGAGGGAGGGG + Intronic
1095687242 12:45050489-45050511 GGGCGCGGCTGGGGAGGGAGGGG + Intronic
1096022490 12:48333800-48333822 GAGCGCCGCCAGGGAGGCAGCGG - Intergenic
1096674679 12:53220160-53220182 GGGCGCCGCCGGGGGAGGAGGGG - Intronic
1096749085 12:53747449-53747471 GGGGTGGGCAAGGGAGGGAGAGG + Intergenic
1096773544 12:53950971-53950993 GGGCACCGGCAGGGAGGGCTGGG + Intergenic
1096789685 12:54037022-54037044 CAGCTCCTCCAGGGAAGGAGAGG - Intronic
1096827563 12:54291585-54291607 GGGCACCACCAGGGAGTGTGGGG + Intergenic
1097794029 12:63843868-63843890 GGGCTCCGCCAGGCGGGGCCAGG - Intergenic
1101522963 12:105502041-105502063 GGGCTGGGAGAGGGAGGGAGAGG + Intergenic
1102136972 12:110583343-110583365 GGGCAGGGCCAGGGAGGGGGCGG - Intergenic
1102463760 12:113115855-113115877 GGGCTCCGTGAGGCAGGGGGAGG + Intronic
1102467046 12:113135907-113135929 GTGCACCGCCAGGTGGGGAGGGG + Intronic
1102578383 12:113871824-113871846 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1103272965 12:119688686-119688708 GGGCTCCCCCAGGCAGGGCATGG - Intronic
1103400523 12:120640524-120640546 GGGCTCCCCCAGGGCGGGGCGGG + Intergenic
1104728424 12:131092206-131092228 TGGCTCAGCCAGGGACCGAGAGG + Intronic
1105716136 13:23066879-23066901 TGGCTCCTGCAGGGAAGGAGGGG - Intergenic
1105871942 13:24512890-24512912 CGGGTCCGCCAGGTGGGGAGCGG + Intergenic
1106703419 13:32254570-32254592 GGGCTCAGACAGGAAGGGTGTGG - Intronic
1107521289 13:41184663-41184685 GGGCTCTACCAGGGAGGTTGAGG + Intergenic
1107612404 13:42129193-42129215 CAGCTCTGCCAGGGAGGCAGAGG - Intronic
1110492540 13:76125680-76125702 GGACTACTTCAGGGAGGGAGGGG + Intergenic
1112328988 13:98462555-98462577 AGGCTCCGCCTGTGAGTGAGAGG - Intronic
1113539189 13:111093402-111093424 TGGCTCCCCCATGGAGGGAGAGG + Intergenic
1113610934 13:111644835-111644857 GGGCAGCGCCAGGGGGGGAAAGG + Intronic
1113672058 13:112182283-112182305 GGCTTCCAGCAGGGAGGGAGGGG + Intergenic
1113928531 13:113954104-113954126 TCACTCAGCCAGGGAGGGAGGGG - Intergenic
1115385424 14:32790770-32790792 GGGGTCTGCCAGGGAGTGGGGGG - Intronic
1115505117 14:34086470-34086492 GAGCTCTGCCAGTGAGGAAGGGG - Intronic
1115540969 14:34420985-34421007 GGGCGCGGCAAGGGCGGGAGAGG + Intronic
1115609542 14:35038509-35038531 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1115850189 14:37584473-37584495 GGGTTCCGCCCGGGAGGCCGGGG + Intergenic
1116430090 14:44836135-44836157 GGGCCCCGCCGGGGTGGGGGAGG - Intergenic
1116871634 14:50073924-50073946 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1117956277 14:61125956-61125978 GGACTCCGGATGGGAGGGAGAGG - Intergenic
1119265018 14:73259383-73259405 GGGCTGCTGCAGAGAGGGAGCGG - Exonic
1119764662 14:77181050-77181072 GGCCCCTGCCTGGGAGGGAGAGG + Intronic
1120835436 14:89035059-89035081 GAGCTCCACGAGGGAGGGACTGG - Intergenic
1121305469 14:92903926-92903948 GAGGTCCGCCAGGGCTGGAGGGG + Intergenic
1121408706 14:93734727-93734749 GGGCTCCACCAGGGCGTGGGCGG - Intronic
1121609322 14:95265155-95265177 GGTCTCAGCCTGGGAGGCAGAGG + Intronic
1121634314 14:95443328-95443350 GGCCACCCCAAGGGAGGGAGAGG - Intronic
1122030351 14:98907436-98907458 GGGCTAGGCCAGGGAGGCAAGGG + Intergenic
1122408479 14:101514111-101514133 GGGCCGAGTCAGGGAGGGAGGGG - Intergenic
1122790370 14:104181854-104181876 GGAGTCCCCAAGGGAGGGAGGGG - Intergenic
1122854784 14:104554813-104554835 GGGCTCGGGCTGGGAGGAAGGGG + Intronic
1122917538 14:104865826-104865848 GGGCCCGGCGGGGGAGGGAGCGG - Intronic
1122964029 14:105112732-105112754 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1124440909 15:29685692-29685714 TGGGCCCTCCAGGGAGGGAGGGG + Intergenic
1124622232 15:31280285-31280307 TGGCTCCCCCAGGGTAGGAGAGG - Intergenic
1125658998 15:41381897-41381919 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1126113403 15:45188024-45188046 GGGCTCCGCCGGGCGGGGAGGGG + Intronic
1126677218 15:51171064-51171086 GGGCTTCGATAGGGAGAGAGAGG + Intergenic
1126979670 15:54227496-54227518 GAGCTCAGGAAGGGAGGGAGGGG - Intronic
1128384377 15:67136843-67136865 GGGCTTCTCCAGGTGGGGAGTGG + Intronic
1128873832 15:71185818-71185840 GGGCTCTTCCAGGGAGGGGTGGG - Intronic
1130728095 15:86461961-86461983 GGGCTGCGTGAGGCAGGGAGGGG - Intronic
1131108419 15:89749957-89749979 GGGTCCCTCCATGGAGGGAGGGG + Exonic
1131179829 15:90232162-90232184 GGGGTCTAGCAGGGAGGGAGTGG + Intronic
1132552646 16:559849-559871 GGGCTCGCCCAGGGAGGGCAAGG + Intergenic
1132653418 16:1031581-1031603 GGGCTCAGCAGGGCAGGGAGGGG + Intergenic
1132663771 16:1072735-1072757 GGGCGCCGGCTGGGAGGGGGCGG - Intergenic
1132683358 16:1152792-1152814 AGGCTCCGGCGGGGTGGGAGGGG - Intergenic
1132688747 16:1172971-1172993 GGGTGCTGCCTGGGAGGGAGGGG + Intronic
1132873977 16:2127893-2127915 GGGATGAGCCAGGGAGGGAGAGG + Intronic
1133213104 16:4273779-4273801 GGGCCCCGGCAGGGAGGGGAGGG + Intergenic
1133223377 16:4328631-4328653 GGGTCCTGCCAGGGAGGCAGGGG - Intronic
1134402206 16:13920440-13920462 GGCCTCTGACAGGGATGGAGGGG + Intronic
1134500684 16:14767154-14767176 GGGCACAGCCAGGAAGGCAGAGG - Intronic
1134527222 16:14953761-14953783 GGGCACAGCCAGGAAGGCAGAGG - Intergenic
1134553064 16:15147067-15147089 GGGATGAGCCAGGGAGGGAGAGG + Intergenic
1134579898 16:15361895-15361917 GGGCACAGCCAGGAAGGCAGAGG + Intergenic
1134714810 16:16352303-16352325 GGGCACAGCCAGGAAGGCAGAGG - Intergenic
1134722687 16:16395665-16395687 GGGCACAGCCAGGAAGGCAGAGG - Intergenic
1134944741 16:18316206-18316228 GGGCACAGCCAGGAAGGCAGAGG + Intergenic
1134952005 16:18356356-18356378 GGGCACAGCCAGGAAGGCAGAGG + Intergenic
1136289365 16:29262186-29262208 GGGCCCCTCCAGGGATGGAGAGG + Intergenic
1136392568 16:29974570-29974592 CGGCTCTGCCAAGCAGGGAGAGG - Exonic
1136511330 16:30739675-30739697 AGGGCCAGCCAGGGAGGGAGGGG - Exonic
1136913896 16:34163566-34163588 AGGATCCGCCAGGGAGAGGGTGG + Intergenic
1137277881 16:46949015-46949037 AGGCTGAGCCAGGGAGGCAGAGG - Intergenic
1139286493 16:65819664-65819686 TGGCTCCACCAGGCAAGGAGGGG + Intergenic
1139478444 16:67215117-67215139 GGGCTCCCCCAGGAACGGACAGG + Intronic
1139965703 16:70744298-70744320 GAGCTCTGCCAGGGTGTGAGGGG - Intronic
1140747745 16:77996056-77996078 GTGATTCGCAAGGGAGGGAGGGG - Intergenic
1141283917 16:82653638-82653660 GGGAGCAGCCAGGGAGGGGGTGG + Intronic
1141531255 16:84648516-84648538 TGGCTCCGCCAGGAAGTGCGAGG - Exonic
1141995592 16:87634750-87634772 GTGACCCGCCAGGGTGGGAGAGG + Intronic
1142003981 16:87680349-87680371 GGGCTGCGCCCGGAAGGAAGCGG + Intronic
1142095111 16:88235166-88235188 GGGCCTCTCCAGGGATGGAGAGG + Intergenic
1142303682 16:89274013-89274035 GGGCTCCGAGGAGGAGGGAGGGG + Intronic
1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG + Exonic
1142352237 16:89585804-89585826 GGGGTCCTCCAGGGAGGGTCAGG + Intronic
1142597912 17:1038577-1038599 GGGCTGGGGCAGGGAGGGATGGG - Intronic
1142812372 17:2401252-2401274 TGGCCCGGGCAGGGAGGGAGAGG + Intergenic
1142904032 17:3031095-3031117 GGGCTCCCCGAAGGAGGCAGGGG + Intronic
1143016485 17:3893389-3893411 GCGCCTCGCCCGGGAGGGAGGGG - Intronic
1143268386 17:5657708-5657730 GGGATCAGGAAGGGAGGGAGGGG + Intergenic
1143383490 17:6510684-6510706 GGGCTCAGACAGGGAGGAAAGGG + Intronic
1143572386 17:7767837-7767859 GGCGTCCGTCAGGGAGGAAGAGG + Intronic
1143896508 17:10140931-10140953 TGGCTCCCCCAAGCAGGGAGTGG + Intronic
1145205660 17:20983979-20984001 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1145791243 17:27628632-27628654 GGGCCCCTCCAGGCAGGGTGTGG + Intronic
1145904577 17:28509194-28509216 GGGCACAGAGAGGGAGGGAGGGG - Intronic
1145997698 17:29113940-29113962 GGGCTCCACCACGGGGAGAGGGG + Intronic
1146127075 17:30238257-30238279 GGACTCTGCCATGGAGGCAGGGG - Intergenic
1146176266 17:30668101-30668123 CGGCGGCCCCAGGGAGGGAGGGG + Intergenic
1146349721 17:32084211-32084233 CGGCGGCCCCAGGGAGGGAGGGG + Intergenic
1146948647 17:36890916-36890938 AGCCTTCGCCAGGGAGGGTGAGG - Intergenic
1147139161 17:38451960-38451982 GGCTTCCGCCAGGGTGGGGGTGG + Intronic
1147341526 17:39755434-39755456 GGGCTCATCCCGAGAGGGAGAGG + Intergenic
1147597744 17:41727612-41727634 GGGCTGTGCCAGGCATGGAGGGG + Intronic
1147598928 17:41734103-41734125 GGGCAACTCCAGGGAGGAAGTGG - Intronic
1147635580 17:41961910-41961932 GGGCTCCTCTGGGGAGGCAGAGG + Intronic
1147742532 17:42677042-42677064 GGGGGCCCCCCGGGAGGGAGGGG - Intergenic
1147963177 17:44179981-44180003 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1148325563 17:46781582-46781604 GGGTTCTGGAAGGGAGGGAGTGG + Intronic
1149649402 17:58267595-58267617 GTCCTCAGCCAGGGAGGGAAGGG + Intronic
1149908720 17:60550813-60550835 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1150675601 17:67244620-67244642 GCCCTCCGCGGGGGAGGGAGGGG + Intronic
1150830154 17:68511959-68511981 TGGGTCGGCCAGGGAGGGGGTGG + Intronic
1150983374 17:70169031-70169053 GGGCTCCGGCAGAGAGGGAGTGG + Intronic
1151546839 17:74798541-74798563 TGGCTCCTCCAGGGAAGGAAAGG - Intronic
1151661598 17:75521885-75521907 TGGCCCGGCCAGGGAGGGGGTGG + Exonic
1151758662 17:76088685-76088707 GGGTTCTCCCAGGGAGGGATGGG + Intronic
1152371346 17:79890606-79890628 GGGTTTCGGCAGGGAGAGAGAGG - Intergenic
1152585099 17:81185807-81185829 AGGCTCTGCCAGGGAGAGAATGG + Intergenic
1152738184 17:82007654-82007676 GGGCTCCTCCAGGGAGGCTCTGG + Intronic
1152738510 17:82008907-82008929 GGCCGGGGCCAGGGAGGGAGTGG + Intronic
1152844839 17:82593431-82593453 GGGCTCCGCCAGGGGGGCGCGGG - Intronic
1154409832 18:14132462-14132484 GCGCGCAGCCAGGGAGGAAGGGG - Intronic
1155085238 18:22452046-22452068 GGGCTCCTCCAGGGAGGGTTTGG + Intergenic
1155723421 18:29048792-29048814 GGGCTGGGTCAGGGAGGGAATGG + Intergenic
1156479242 18:37425923-37425945 GACATCAGCCAGGGAGGGAGAGG + Intronic
1157307609 18:46528584-46528606 TGGATCCACCTGGGAGGGAGTGG + Intronic
1157328254 18:46684871-46684893 GGGTTTAGCCAGGGAAGGAGTGG + Intronic
1157794131 18:50559711-50559733 GGGCTCCGTCCGGGAGGGAGGGG - Intergenic
1160231284 18:77051497-77051519 GGGCTCCTCCGGGGAGGGTGAGG + Intronic
1160764046 19:799167-799189 GGGGTCCTGCTGGGAGGGAGGGG + Intronic
1160798312 19:955694-955716 GGGCTGTGCCAGGGAAGGGGGGG + Intronic
1160803093 19:979586-979608 GGGCTCCTCCAGGCAGTGAGTGG - Intergenic
1160863451 19:1247514-1247536 GGGCTAGGCCAGAGAGGGAGAGG - Intergenic
1161002491 19:1917863-1917885 GGGCTCCCCGAGGGAGGGAGTGG + Intronic
1161029395 19:2050861-2050883 GGGCCCCGCCAGCGGGGGAGGGG + Exonic
1161205011 19:3036373-3036395 GGGAGCCGGCAGGGAGGGAGCGG - Intronic
1161208882 19:3056217-3056239 GGGCACCCCCAGGCAGGTAGCGG - Intronic
1161476906 19:4491273-4491295 GGGCTGCGCCGGGGGGGGTGGGG - Intronic
1161594381 19:5143788-5143810 GGGCTTGGCCAGGGAGGCTGCGG + Intronic
1161716653 19:5880027-5880049 GTACTCCAACAGGGAGGGAGAGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161967504 19:7556596-7556618 GGGCTCCTCCGGGGAGGGGTAGG - Intronic
1162156123 19:8679115-8679137 GGGGGCAGCCAGGGAGAGAGAGG - Intergenic
1162518707 19:11166400-11166422 GGGCTCCCCCAGGGAAGCAGAGG + Intronic
1162727692 19:12699995-12700017 GGGCTCCCCTAGAGAGGGTGGGG - Exonic
1162780187 19:13002689-13002711 TGGCTGCGCCAGCCAGGGAGGGG + Intronic
1162800103 19:13105440-13105462 GGGCTCAGCCAGGGAAAGAAGGG - Intronic
1162886684 19:13702739-13702761 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1163086015 19:14979973-14979995 GCGCTCCGCCAGGGATGCTGGGG - Intronic
1163358337 19:16829552-16829574 GGGTTCCCCGAGGGAGGGCGGGG - Intronic
1163368116 19:16887709-16887731 GGGCTCCCCCAGGCAGGAAACGG + Intergenic
1163477301 19:17533832-17533854 GGGCTGCTGCAGGCAGGGAGTGG - Intronic
1163830926 19:19546854-19546876 GGGCTACAGCAGGCAGGGAGGGG + Intergenic
1163906095 19:20150745-20150767 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1164191900 19:22925486-22925508 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1164653348 19:29901738-29901760 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1165065197 19:33224659-33224681 GAGCCCCTCCAGGGAGGGACAGG - Intronic
1165071893 19:33260683-33260705 GGGCTGCACCAGGGAGGGGCCGG - Intergenic
1165774367 19:38396024-38396046 GGGCACTGCCAGGGAGAGCGCGG - Exonic
1165922478 19:39307674-39307696 GGGCTCCGCCAGGGCGTGCCTGG - Exonic
1166261430 19:41644209-41644231 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1166265591 19:41682360-41682382 GGACTCTGCAAGGGAGGGAAGGG - Intronic
1166345188 19:42161346-42161368 GGGCTTCGTCAGAGAGGGAGAGG + Intronic
1166354783 19:42220487-42220509 GGCCTGCGCTAGGGCGGGAGCGG + Intronic
1166374880 19:42322114-42322136 GGGCCCAGCCACCGAGGGAGGGG + Intronic
1166677413 19:44748475-44748497 GGCCTCGGCGGGGGAGGGAGAGG - Intronic
1166780717 19:45341050-45341072 GGGCGGGGCCTGGGAGGGAGAGG + Intronic
1167391848 19:49200477-49200499 GGGTGGGGCCAGGGAGGGAGTGG + Intronic
1167621463 19:50563287-50563309 TGGCTCCGCCAGACAGGGGGTGG - Intronic
1167794573 19:51701257-51701279 GGGATGGGACAGGGAGGGAGGGG + Intergenic
1167860189 19:52276940-52276962 GGGCTTCTCCAGGAGGGGAGCGG + Intronic
1167969963 19:53183170-53183192 GGGCTTCTCCAGGAGGGGAGTGG - Intronic
1168093808 19:54103024-54103046 GGGCTCCTCCAGGGCAGGGGTGG + Intronic
1168200440 19:54811312-54811334 GGCTTCAACCAGGGAGGGAGAGG + Intronic
1168465157 19:56595595-56595617 GGCCGGGGCCAGGGAGGGAGAGG + Intronic
1168468992 19:56625722-56625744 GTGCTGGGCCAGGAAGGGAGAGG - Exonic
1168607272 19:57769974-57769996 GGCCTCTGTCAGGGACGGAGAGG + Intronic
925204314 2:1993287-1993309 GGGGTCCGCCAGGTGGGGATTGG + Intronic
925208433 2:2026714-2026736 GGGCCCCGCCCTGGACGGAGAGG - Intronic
926718267 2:15941246-15941268 GTCCTCTTCCAGGGAGGGAGAGG - Intronic
929539846 2:42811052-42811074 GGGCCCCGCCCGGGGGCGAGGGG - Intergenic
930641602 2:53859591-53859613 GGGCTCAGCCAGGGTAGGGGCGG + Intronic
931186782 2:59960177-59960199 GAACTTCGCCAGGGAGGGAGGGG - Intergenic
932425515 2:71631898-71631920 GGGCTCCATCAGGGAGGAGGAGG + Intronic
932592952 2:73078130-73078152 GGGCTGTGCCAGGGAAGGGGAGG + Intronic
932691286 2:73915870-73915892 GGGCTGGGGCAGGGATGGAGGGG + Intronic
932769375 2:74492083-74492105 GGGCTACCCCAGGGAGGGTGGGG - Intronic
933354260 2:81194820-81194842 GGACTCCACCAGCGAGGGAGGGG + Intergenic
933560082 2:83877335-83877357 GGGCTCGGCAAGGGTGAGAGGGG + Intergenic
933639260 2:84741679-84741701 GTGCTGCTCCAGGGAGGGAGAGG - Intronic
934980217 2:98833343-98833365 CGGCTGCCCCAGGGAGGGTGAGG + Intronic
935603666 2:104948032-104948054 GGGCTCTGGCAGAGTGGGAGTGG - Intergenic
935622909 2:105144340-105144362 GGCCACCGCCCGGGAGGGCGCGG + Intergenic
935926037 2:108069712-108069734 GGGCTCCTGCAGGCAGGAAGAGG + Intergenic
935978832 2:108606727-108606749 GAGCTCCCCCAGGGAGGCAGTGG - Intronic
936234609 2:110732480-110732502 GGGCGGGGCCGGGGAGGGAGGGG + Intergenic
936545979 2:113393780-113393802 GAGCGCCGCCAGGGAGGCAGCGG + Intergenic
937277816 2:120696688-120696710 GGGCTGGGGAAGGGAGGGAGGGG + Intergenic
937283621 2:120736550-120736572 GCTCTCCCCCAGGTAGGGAGAGG - Intronic
937508281 2:122561879-122561901 GAGCTCATCCAGGGAGTGAGCGG + Intergenic
937919700 2:127120535-127120557 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
938069792 2:128302441-128302463 GGGCTGGGGCTGGGAGGGAGTGG - Intronic
938207158 2:129433779-129433801 GAGCTCCACCAGCCAGGGAGAGG - Intergenic
938263659 2:129911755-129911777 GAGCTCCGGCAGGGAGGCTGGGG - Intergenic
939153843 2:138501851-138501873 GGGCTGCGCGGGGGCGGGAGTGG + Exonic
941819111 2:169827450-169827472 CGGCTCCTCCAGGGAGAGTGAGG - Intronic
941905425 2:170714052-170714074 GTGAGCCGCCAGGGAGGGATGGG + Exonic
942098509 2:172556010-172556032 GGGCTCCGGCTAGGAGGGTGGGG + Exonic
943811502 2:192194716-192194738 GGGCTCAGCCCCGGAGCGAGAGG + Exonic
945435198 2:209809981-209810003 GGGCTCCTTCGGGGAAGGAGTGG - Intronic
946322568 2:218962181-218962203 GGGCCCCGGGAGGGAGGGAGTGG + Intergenic
947612052 2:231530534-231530556 GTCCTCCGCCAGTGCGGGAGGGG - Intergenic
947751483 2:232535040-232535062 GGGCCCAGCCATGGAGGCAGAGG - Intronic
947913378 2:233817035-233817057 GGGCTGGGTCAGGGAGGGAGAGG + Intronic
948121443 2:235533962-235533984 GAACTTCTCCAGGGAGGGAGTGG + Intronic
948263762 2:236622859-236622881 GGGGTCCACCAGGGAGAGAGGGG - Intergenic
948495587 2:238346490-238346512 TGGCTCTGGCAGGGAGAGAGGGG - Intronic
948710087 2:239819975-239819997 GGGAGTCCCCAGGGAGGGAGTGG + Intergenic
949035049 2:241812356-241812378 GGGCCCTGTCAGGGAGGGCGGGG + Intronic
1169033441 20:2430899-2430921 GGGCCCAGCCATGGTGGGAGTGG + Exonic
1169084110 20:2816308-2816330 GGGCTCCTCTGGGGAGGGTGGGG + Intronic
1169262391 20:4148608-4148630 GGCCCCTGCTAGGGAGGGAGGGG + Intronic
1170226287 20:13995277-13995299 GGGCGGAGCCAGGGAGCGAGGGG - Intronic
1170226295 20:13995298-13995320 GGGCGGAGCCAGGGAGCGAGGGG - Intronic
1170425179 20:16228445-16228467 GAGCACCGCCCGGGAGGCAGCGG - Intergenic
1170559834 20:17547422-17547444 GGGCTCCTCCTGGGATGGTGTGG + Intronic
1170728290 20:18948870-18948892 GGCCTGGGCCAGGGAAGGAGAGG + Intergenic
1171223200 20:23420479-23420501 GGGCCCCGCCGGGGAGGGGGCGG - Intronic
1172350070 20:34231372-34231394 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1173337229 20:42122627-42122649 GGCCTCAGCCAGGGAGGATGAGG - Intronic
1174812829 20:53661982-53662004 GAGCTCCGACAAGCAGGGAGAGG - Intergenic
1175962821 20:62645767-62645789 TGGCTGCGCGTGGGAGGGAGAGG - Intronic
1176005659 20:62861184-62861206 CGGCGCCGCCAAGGAGGGCGCGG - Exonic
1176030104 20:63007582-63007604 GGGCTCCCCGGGGGTGGGAGGGG + Intergenic
1176369151 21:6052118-6052140 TGACTCTGCCAGGGAGGGGGTGG + Intergenic
1176863390 21:14027388-14027410 GCGCGCAGCCAGGGAGGAAGGGG + Intergenic
1177568398 21:22853730-22853752 GGGCTCAGCCAGAGTGGGAGTGG - Intergenic
1177756564 21:25355858-25355880 GAACTCCCCCAGGGAGGCAGAGG - Intergenic
1179754368 21:43486423-43486445 TGACTCTGCCAGGGAGGGGGTGG - Intergenic
1180180858 21:46118167-46118189 GGGCTCCACCTGGGAGGAGGTGG - Intronic
1180649881 22:17369317-17369339 CTGCACCGCCAGGGAGGGGGAGG - Intronic
1180939109 22:19645257-19645279 GTGCCCAGCCAGGGAGCGAGAGG - Intergenic
1181500612 22:23313649-23313671 GGGCTCCTCTGGGGAGGGGGTGG + Intronic
1181673099 22:24435055-24435077 GGGCTGCTCCAGGGAAGGGGAGG + Intronic
1181734455 22:24870731-24870753 GGGCTGCTCCAGGGAGGCACTGG - Intronic
1182020810 22:27080187-27080209 TTGCTCCGCCAGGGAGGGGGAGG - Intergenic
1182667576 22:31970799-31970821 AGGCTGCGCCTGGAAGGGAGGGG - Intergenic
1183277820 22:36912317-36912339 GGGCTTCTCCAGGGCTGGAGAGG - Intergenic
1183308484 22:37096768-37096790 GGGCACCTCCAGGTAGGAAGTGG - Intronic
1183415108 22:37677254-37677276 AGGCTACAGCAGGGAGGGAGCGG - Intronic
1183438239 22:37807780-37807802 GGGATCCGCCAGGGACCGAGAGG - Intergenic
1183639907 22:39086594-39086616 GGGGTCAGCCAGGGCAGGAGAGG + Intronic
1183841644 22:40502749-40502771 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1183845097 22:40536403-40536425 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1183928752 22:41224287-41224309 GTGCTTCCCCAGGGACGGAGTGG + Intronic
1184670882 22:46011859-46011881 GTCCTCCCCCAGGGAGGGATGGG + Intergenic
1184769203 22:46587992-46588014 GGGCACAGGCGGGGAGGGAGTGG + Intronic
1184776415 22:46625734-46625756 GGGGCCAGCCAGGCAGGGAGAGG - Intronic
1185128557 22:49025013-49025035 GGGCTCAGCCAGGGAGGGAGCGG - Intergenic
1185129240 22:49028282-49028304 GGACTCCTCCAGGCAGGGTGAGG - Intergenic
1185398232 22:50603428-50603450 GGGCTCCTCCACGGAAGGGGAGG - Exonic
1185409495 22:50674539-50674561 GGGCTCCGGCGGGGGGGAAGGGG + Intergenic
1185420331 22:50731323-50731345 GGGCACGGCCGGGGCGGGAGTGG - Intergenic
950196179 3:11010905-11010927 TGGCCCCGCCATGGAGTGAGTGG - Intronic
950198394 3:11025900-11025922 GGGCTCGGCCAGGAAGGAAGGGG - Intronic
950452489 3:13073158-13073180 GGGCTCCTCCAGGGAGGCTGGGG + Intergenic
951013746 3:17705943-17705965 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
953558340 3:43964675-43964697 GGGCTCTGCCAGAGAGAAAGGGG + Intergenic
953741791 3:45544894-45544916 GGGCTGAGCCAGGGAGGTACTGG + Intronic
954080512 3:48210827-48210849 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
954327198 3:49869980-49870002 AGGCTCCGCCAGGGTCGGGGCGG - Exonic
955297212 3:57746921-57746943 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
956144845 3:66182233-66182255 GGGCTCTCCTAGGGAGTGAGTGG + Intronic
957030020 3:75229420-75229442 GGACTAAGGCAGGGAGGGAGTGG + Intergenic
959042487 3:101438832-101438854 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
959419600 3:106112670-106112692 GAGCGCCGCCGGGGAGGCAGCGG - Intergenic
959678146 3:109060768-109060790 GGGCACTGCCAGGCAGGGTGGGG - Intronic
960684759 3:120285280-120285302 GGGCGGCGCCAGGGAGGGGCGGG - Intergenic
961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG + Intergenic
961377277 3:126475493-126475515 GGGCTACGCCAGGGCCGGGGGGG + Exonic
961479700 3:127171870-127171892 GGGCTGCGCCAGGGAGGCATAGG + Intergenic
961663259 3:128481512-128481534 GGGCAGAGCCAGGGAGGGTGTGG - Intronic
963038677 3:141052775-141052797 GGGCTCTGGGAAGGAGGGAGGGG + Intronic
966359441 3:179119456-179119478 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
967217260 3:187220985-187221007 GGGCGCTGCCAGCCAGGGAGTGG - Intronic
968074251 3:195807905-195807927 GGGCTCAGCCGTGGAGGCAGAGG - Intronic
968292239 3:197547720-197547742 AGGGGCCTCCAGGGAGGGAGAGG - Intronic
968353215 3:198080286-198080308 GGGCTCAGCCGGGGTGGGAGGGG - Intergenic
968461817 4:730041-730063 GGCCTCAGACAGGGAGGGAGGGG - Intronic
968620313 4:1600960-1600982 GGGCCCAGCCCTGGAGGGAGGGG + Intergenic
968650193 4:1757341-1757363 GGGCTGCTCCAGGCAGGGGGAGG + Intergenic
968756772 4:2420221-2420243 GAAATCCCCCAGGGAGGGAGTGG - Intronic
968869627 4:3235079-3235101 GGGCTCAGCCACTCAGGGAGTGG + Intronic
969321998 4:6417992-6418014 GGGCTCTGGAAGGGAAGGAGGGG + Intronic
969503710 4:7570690-7570712 GGGGTCTGGCAGGGAGGGAAGGG - Intronic
969507575 4:7597657-7597679 GGGCTCTGCCATAGAGGGAGGGG + Intronic
969510595 4:7615427-7615449 GGCATGTGCCAGGGAGGGAGAGG + Intronic
973823761 4:54685184-54685206 GAAATCCCCCAGGGAGGGAGTGG - Intronic
974047239 4:56908235-56908257 GGGCTCGGTCAGGGTGGGGGAGG + Intronic
975219732 4:71800233-71800255 GGGGCCTGCCAGGGAGGGTGAGG - Intronic
977997163 4:103508509-103508531 GGACTCTAGCAGGGAGGGAGAGG + Intergenic
982616113 4:157637790-157637812 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
982875754 4:160647191-160647213 GGGCTACAAGAGGGAGGGAGAGG + Intergenic
983919785 4:173333768-173333790 GGGCGCGGGCAGGGCGGGAGCGG - Intronic
985126373 4:186698752-186698774 CGGCTCCGCCACGGAGAGACTGG + Intronic
985539550 5:481767-481789 GGGCTGGGCCAGGAGGGGAGAGG - Intronic
985539606 5:481921-481943 GGGCTGGGCCAGGAGGGGAGAGG - Intronic
985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG + Intronic
986720727 5:10559459-10559481 GGGGTCAGCCAGGGCTGGAGAGG - Intergenic
987078627 5:14406561-14406583 TTGCACCGCCAGGGATGGAGAGG + Exonic
987392365 5:17387964-17387986 GGGCTATGCCAGGGTGGCAGAGG - Intergenic
990545215 5:56815526-56815548 GGCCCCTGCGAGGGAGGGAGGGG - Intergenic
992373706 5:76171039-76171061 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
992977844 5:82138884-82138906 CGGCTCCGCATGAGAGGGAGAGG - Intronic
993514453 5:88813453-88813475 GGGCTGGGCCTGGGAGGGTGAGG - Intronic
993915904 5:93742179-93742201 GTTCTGCCCCAGGGAGGGAGTGG - Intronic
997429155 5:133825626-133825648 AGGCTTCACCAGGCAGGGAGGGG + Intergenic
997736502 5:136216349-136216371 AGGCTCTTCAAGGGAGGGAGGGG - Intronic
999770845 5:154774394-154774416 GGTCTGCTCCAGGGAGTGAGGGG + Intronic
1000985233 5:167858809-167858831 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1001154274 5:169259408-169259430 GGGCTACAACAGGTAGGGAGAGG + Intronic
1001630111 5:173168657-173168679 GGGCTCAGCCTGGGGGTGAGGGG + Intergenic
1002013476 5:176304229-176304251 CGGCTCCGCATGAGAGGGAGAGG - Intronic
1002341426 5:178518839-178518861 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1002485770 5:179535255-179535277 GGGCTGGGCAAGGCAGGGAGAGG - Intergenic
1002764749 6:229280-229302 GGGCTCAGCCAGGCAGTGGGTGG + Intergenic
1003645427 6:7910278-7910300 GGGCTCCGGCTGGCGGGGAGCGG - Intronic
1004387934 6:15188426-15188448 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1006300104 6:33189410-33189432 GGACACCATCAGGGAGGGAGGGG + Exonic
1006492116 6:34396959-34396981 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1006639104 6:35479886-35479908 GGGCCCTGTCAGTGAGGGAGAGG - Intronic
1007674442 6:43581589-43581611 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1008920977 6:56843837-56843859 TGGCTCTGCCTGGGAGGGAGGGG - Intronic
1010402185 6:75458613-75458635 GGTCTCCGGCTGGGAGGAAGAGG + Intronic
1011405437 6:87010844-87010866 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1011419443 6:87155867-87155889 CGCCTCCGCCTGGGTGGGAGCGG + Intronic
1013730820 6:113164565-113164587 AGGCTCAGCCTGGGAGGCAGAGG + Intergenic
1014137754 6:117907961-117907983 GGGCCGCCCCAGGGACGGAGGGG - Intronic
1015476525 6:133664269-133664291 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1016710502 6:147165785-147165807 GAGCTCAGGCAGGGAGAGAGAGG - Intergenic
1017814437 6:158006588-158006610 GGGATCCCCTAGGGAGTGAGTGG - Intronic
1018053295 6:160030266-160030288 GGCGTCCCCCAGGGAGGGAGGGG + Intronic
1018512014 6:164534261-164534283 GTGCTTCCCCAGGGAGGAAGGGG - Intergenic
1018707970 6:166476653-166476675 GGCCTCCCCCAGGGAGAGAGGGG - Intronic
1018899847 6:168045547-168045569 GAGCTGTGCCAGGCAGGGAGGGG + Intergenic
1019378976 7:711747-711769 GGGCTCAGGCAGGGGGGGAGGGG + Intronic
1019543545 7:1561942-1561964 GGTCTGAGCCAGGGAGGCAGAGG - Intergenic
1019925901 7:4191645-4191667 CTGCTCCGCCAGGGAGAGGGAGG + Intronic
1019967951 7:4515553-4515575 GAGCTCTGCCATGGAGGGTGAGG + Intergenic
1020023350 7:4882403-4882425 GGGCTCGGACAGCGAGGGTGTGG + Intronic
1020107789 7:5430182-5430204 GGGAGCCGGCAGGGAGGGGGTGG - Intergenic
1020616642 7:10466464-10466486 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1021411159 7:20331050-20331072 ACTCCCCGCCAGGGAGGGAGCGG + Intronic
1021872134 7:25017934-25017956 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1022629384 7:32070924-32070946 AGGCGCGGCCAGGGAGTGAGCGG - Intronic
1022924021 7:35042449-35042471 GGGCTTGGGGAGGGAGGGAGTGG - Intergenic
1023884945 7:44348023-44348045 TGTCTCCTCCAGGGTGGGAGTGG + Intergenic
1023909201 7:44541657-44541679 AGGCTGAGCCAGGGAGGGTGCGG - Intergenic
1023922344 7:44639337-44639359 GGGCCCCACCAGGAAGGAAGTGG + Intronic
1023966744 7:44966833-44966855 GGGCTCCTGCAGGGACAGAGGGG + Exonic
1025086174 7:56025359-56025381 AGGCTGAGCCAGGGAGGCAGAGG - Intronic
1025086710 7:56029302-56029324 TGGCTCTAACAGGGAGGGAGAGG + Intronic
1025806433 7:64838121-64838143 GGGCTCGGCAAGGGTGAGAGGGG + Intergenic
1027424365 7:78047596-78047618 GGCCTCCACCAGGGTGGGAGTGG - Intronic
1028198611 7:87934893-87934915 GGGTTCCGAGAGGGAGGGGGCGG + Intronic
1029270610 7:99374854-99374876 GGGCGCCGCCTGGGAGTGAGCGG + Intronic
1029403072 7:100357330-100357352 AGCCCCTGCCAGGGAGGGAGAGG + Intronic
1029405688 7:100373071-100373093 AGCCCCTGCCAGGGAGGGAGAGG + Intronic
1029491925 7:100875352-100875374 GGGCCCCGCTGGGGCGGGAGAGG + Intronic
1029507715 7:100972348-100972370 GGGATCCTCTAGGGAAGGAGAGG - Intronic
1029640624 7:101817017-101817039 GGGGTCCGCCACGGAGGAACAGG - Intronic
1030115787 7:106061290-106061312 GTGGGACGCCAGGGAGGGAGAGG - Intergenic
1030699345 7:112621656-112621678 GGGCTCCGGCACTGAAGGAGGGG + Intergenic
1034347667 7:150397241-150397263 GGGCTCTGCCAGGGCTGGTGGGG + Exonic
1034476054 7:151282754-151282776 TGGCTCAGCCAGGGAGGGGAAGG - Intergenic
1034494119 7:151410003-151410025 GCGCTCGGCCGGGGAGGGCGCGG - Intronic
1034733961 7:153412113-153412135 GGGCTCGGCAAGGGTGAGAGGGG + Intergenic
1034887179 7:154806839-154806861 GGGCTCCAGCAGGGAGACAGAGG + Intronic
1034979716 7:155468003-155468025 GGGCTCAGCCCTGGAGGGGGCGG - Intergenic
1035112094 7:156491906-156491928 GGGCTCACCCAGGAAGGAAGCGG - Intergenic
1035335927 7:158126876-158126898 GGGATCCGCCGGCCAGGGAGAGG - Intronic
1035508119 8:150626-150648 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1036536883 8:9658337-9658359 GAGCGCCGCCTGGGAGGCAGCGG - Intronic
1036786648 8:11692567-11692589 CGGCTCCGCCTGGGAGGGCGTGG + Intronic
1037811489 8:22089442-22089464 GGGCGCGGCCGGGGAGGCAGAGG - Intronic
1037901487 8:22691912-22691934 GGGCATCGCCGGGGAGGGAAAGG - Intronic
1038036429 8:23690572-23690594 TGGCTCAGCCAGGGAGGGAGGGG + Intergenic
1039458956 8:37727490-37727512 GAGCTCTGCAGGGGAGGGAGCGG - Intergenic
1039608420 8:38901172-38901194 GGAGCCCGCCGGGGAGGGAGAGG - Intergenic
1040581835 8:48704629-48704651 GGCCTGCGGCCGGGAGGGAGAGG - Intergenic
1042048805 8:64685164-64685186 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1044660456 8:94590194-94590216 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1044698908 8:94949172-94949194 GGGCTGCGCGGGGAAGGGAGCGG + Exonic
1044999647 8:97868851-97868873 GGGCTCAGGCACGGACGGAGTGG + Intronic
1045638723 8:104223497-104223519 GGGCTGGGTCAGGGAGGCAGGGG + Intronic
1047687109 8:127315859-127315881 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1047848281 8:128827163-128827185 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1048445993 8:134493738-134493760 TGGCTCAGCCGGGGAGGGAAGGG - Intronic
1049290670 8:141799995-141800017 GGCCAGAGCCAGGGAGGGAGAGG + Intergenic
1049405469 8:142450147-142450169 GGGCGCAGCGAGGGTGGGAGGGG + Intronic
1049411643 8:142476271-142476293 GGGCTGCGGAAGGGAGGCAGGGG + Intronic
1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG + Intergenic
1049532293 8:143160491-143160513 GGGCGCCGCGAGGGAGGGAGCGG - Intronic
1049776660 8:144409170-144409192 GGGCTGCGCAAGGCCGGGAGAGG + Exonic
1050090639 9:2014891-2014913 GGGCTCCTCCAGGGAGACTGCGG - Intergenic
1050438066 9:5629726-5629748 GGGCTCGGCCGGGGAGCGTGCGG - Intronic
1052799733 9:32956220-32956242 GGGCTGCGCCCGGGAGGGTCCGG - Intergenic
1053163710 9:35829992-35830014 GGGTTCCGGCAGGGAGGGGTGGG + Intronic
1053454982 9:38226950-38226972 GGGGGTCGGCAGGGAGGGAGGGG + Intergenic
1053457059 9:38241530-38241552 GAGCGCCGCCCGGGAGGCAGCGG + Intergenic
1055030702 9:71769208-71769230 AGGCTCAGCCAGGGAGTGACAGG - Intronic
1056340761 9:85629448-85629470 AGGCTCAGTCAGGGAGAGAGAGG + Intronic
1057379188 9:94553689-94553711 GGGCACCACGGGGGAGGGAGGGG - Intergenic
1057519821 9:95751894-95751916 GAGCTGCGAGAGGGAGGGAGGGG + Intergenic
1059210851 9:112513690-112513712 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1060064770 9:120495043-120495065 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1060102902 9:120856189-120856211 GGGCTGTGCCAGGGAAGCAGAGG + Exonic
1060143711 9:121233134-121233156 GGGCTCCAAGAGGGAGGAAGAGG - Intronic
1060764221 9:126281860-126281882 GGGGTCAGCCTGGGAGGCAGGGG - Intergenic
1060789016 9:126473281-126473303 GGGCTATGGCAGGGAAGGAGGGG - Intronic
1060892867 9:127199521-127199543 GGGATCCTCGAGGGAGGCAGAGG - Intronic
1060892873 9:127199542-127199564 GGGATCCTCGAGGGAGGCAGAGG - Intronic
1060892879 9:127199563-127199585 GGGATCCTCGAGGGAGGCAGAGG - Intronic
1060892885 9:127199584-127199606 GGGATCCTCGAGGGAGGCAGAGG - Intronic
1061177865 9:129008410-129008432 AGGCTCCACTAAGGAGGGAGGGG - Exonic
1061799239 9:133105123-133105145 GAGCTGTGCCACGGAGGGAGAGG + Intronic
1061984100 9:134119079-134119101 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1061991068 9:134159069-134159091 GGGCTCCAGCAGGGACGGCGAGG - Exonic
1061992581 9:134167599-134167621 GGGCTCTGCCAGGGCTGGAAGGG - Intergenic
1062194855 9:135267280-135267302 TGGCAGAGCCAGGGAGGGAGGGG - Intergenic
1062500526 9:136850150-136850172 GGCCTCCGGCAGGGCGGGACGGG - Intronic
1062521153 9:136958559-136958581 AGGCACCGCCAGGGAGGAGGAGG - Intergenic
1062524170 9:136971623-136971645 GGGCTGGGCTGGGGAGGGAGGGG + Exonic
1062529951 9:136995415-136995437 GAGCCCCGGCAGGGTGGGAGGGG - Intronic
1062629709 9:137458326-137458348 GGGCTCGGGCAGGGAGGGCAGGG + Intronic
1062645029 9:137543503-137543525 GGCCTCCAGCAGGGAGGGCGGGG + Exonic
1062696292 9:137877878-137877900 CGGCCCCGGCAGGGAGGGCGCGG - Exonic
1185556067 X:1022203-1022225 GGGGCCCGCCAGGGGTGGAGGGG + Intergenic
1187976705 X:24710086-24710108 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1191618321 X:63190352-63190374 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1192174207 X:68875682-68875704 GGGCTCAGCCAGGAGGAGAGTGG + Intergenic
1192621071 X:72680824-72680846 GAGCGCCGCCCGGGAGGCAGCGG + Intronic
1195036330 X:100973410-100973432 GAGCGCCGCCCGGGAGGCAGCGG - Intronic
1195242313 X:102964738-102964760 GGGCTCAGCAAGGGGGCGAGAGG - Intergenic
1196404624 X:115348286-115348308 GAGCGCCGCCCGGGAGGCAGCGG - Intergenic
1197873486 X:131081992-131082014 GGGGTCTGGCAGGGTGGGAGGGG + Intronic
1198322125 X:135528447-135528469 AGGCTCCGGCAGAGAGGGTGAGG + Intronic
1199336048 X:146620079-146620101 GGGCTCCGCCAGGGAGGGAGGGG + Intergenic
1199980691 X:152918812-152918834 AGGCTCGAACAGGGAGGGAGGGG + Intronic
1200039394 X:153354860-153354882 GGGCTGGGGCAGGGATGGAGAGG - Intronic
1200068809 X:153517898-153517920 GGGCGCCGCCGGGGTGGGCGCGG + Intronic
1200173614 X:154097176-154097198 GGGGCGCGCGAGGGAGGGAGGGG + Intronic
1200181717 X:154154984-154155006 GGACTCCTCCAGGGAGGGAGTGG - Intronic
1200187366 X:154192098-154192120 GGACTCCTCCAGGGAGGGAGTGG - Intergenic
1200193015 X:154229238-154229260 GGACTCCTCCAGGGAGGGAGTGG - Intronic
1200198770 X:154267042-154267064 GGACTCCTCCAGGGAGGGAGTGG - Intronic
1200336292 X:155354249-155354271 GAGCTCCCGGAGGGAGGGAGGGG + Intergenic
1200350178 X:155486978-155487000 GAGCTCCCGGAGGGAGGGAGGGG - Intergenic
1201719890 Y:17084905-17084927 GGGCTGCACAAGGGAGCGAGAGG - Intergenic
1201770255 Y:17611737-17611759 GGGCTCGGCAAGGGTGAGAGGGG - Intergenic
1201831299 Y:18294250-18294272 GGGCTCGGCAAGGGTGAGAGGGG + Intergenic