ID: 1142304599

View in Genome Browser
Species Human (GRCh38)
Location 16:89278390-89278412
Sequence GCTCAGAGCAGGGCCCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142304591_1142304599 21 Left 1142304591 16:89278346-89278368 CCAGGGCAGAGAGTGCACAGGGC 0: 1
1: 0
2: 3
3: 51
4: 366
Right 1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG 0: 1
1: 0
2: 0
3: 22
4: 185
1142304585_1142304599 30 Left 1142304585 16:89278337-89278359 CCCCGCGGCCCAGGGCAGAGAGT 0: 1
1: 0
2: 2
3: 16
4: 175
Right 1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG 0: 1
1: 0
2: 0
3: 22
4: 185
1142304586_1142304599 29 Left 1142304586 16:89278338-89278360 CCCGCGGCCCAGGGCAGAGAGTG 0: 1
1: 0
2: 2
3: 47
4: 368
Right 1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG 0: 1
1: 0
2: 0
3: 22
4: 185
1142304587_1142304599 28 Left 1142304587 16:89278339-89278361 CCGCGGCCCAGGGCAGAGAGTGC 0: 1
1: 0
2: 3
3: 38
4: 283
Right 1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG 0: 1
1: 0
2: 0
3: 22
4: 185
1142304596_1142304599 -9 Left 1142304596 16:89278376-89278398 CCTCATGGGAATGTGCTCAGAGC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG 0: 1
1: 0
2: 0
3: 22
4: 185
1142304595_1142304599 -8 Left 1142304595 16:89278375-89278397 CCCTCATGGGAATGTGCTCAGAG 0: 1
1: 0
2: 2
3: 9
4: 154
Right 1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG 0: 1
1: 0
2: 0
3: 22
4: 185
1142304589_1142304599 22 Left 1142304589 16:89278345-89278367 CCCAGGGCAGAGAGTGCACAGGG 0: 1
1: 0
2: 2
3: 48
4: 404
Right 1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG 0: 1
1: 0
2: 0
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142304599 Original CRISPR GCTCAGAGCAGGGCCCCATT TGG Intronic
901228444 1:7628685-7628707 GCTCAGAACTGTGCCCCATTAGG - Intronic
901403513 1:9031215-9031237 GCTCAGAGGAGGCCCACAGTAGG + Intergenic
902686031 1:18078233-18078255 TCCCAGAGCAGGGCCCCCTTTGG - Intergenic
903647467 1:24903952-24903974 GCACAGAGCAGGGGTCCATGAGG + Intronic
904348606 1:29890455-29890477 GCTCAGAGCTGGGACCCACAGGG + Intergenic
906157066 1:43620002-43620024 GATCTGAGCAGGGCCCCAAGGGG + Intronic
913221911 1:116667126-116667148 GCCCAGAGCAGGGCAACAGTGGG + Intronic
913333687 1:117687731-117687753 GGTCAGAGCAGGGCCGCTGTAGG + Intergenic
915949299 1:160177461-160177483 GTTCAGAGAAGGGCCCCAAAAGG - Intronic
918963167 1:191306414-191306436 GCTCAGAGGAGAGCCGCACTGGG + Intergenic
923348984 1:233085361-233085383 GCTTTTTGCAGGGCCCCATTAGG + Intronic
923368559 1:233287400-233287422 GCTCATGGCAGGGACCCAATGGG + Intronic
1063268437 10:4479746-4479768 GCTCAAAGCATGGCCATATTTGG + Intergenic
1063337862 10:5234157-5234179 GCTCTGAGCATGGCCACATTGGG - Intergenic
1063663014 10:8046778-8046800 GTTCAGACCAAGACCCCATTGGG + Intergenic
1066177421 10:32923364-32923386 GCTCAGACAAGGGCCTCACTGGG - Intronic
1067031270 10:42879865-42879887 GCACAGGGCAGGGCACCATCAGG + Intergenic
1067058416 10:43065409-43065431 GCTGGGAGCAGGGGCCCATCTGG - Intergenic
1069214320 10:65800324-65800346 GCTCAGAATGGGGCCCTATTTGG - Intergenic
1071233398 10:83615608-83615630 GCACAGAGCTGTGCCACATTAGG + Intergenic
1071762278 10:88621985-88622007 GGTCTGAGCAGGGCACCAATAGG - Intergenic
1072656545 10:97334232-97334254 GCGCAGCGCAGGGCCCCAGAGGG + Exonic
1073946004 10:108751252-108751274 GCTTAGAGCATATCCCCATTGGG - Intergenic
1074317966 10:112376260-112376282 GCTCAGAGCAGGGCAGAACTGGG + Exonic
1074778679 10:116785123-116785145 TCTCAGAGCAGGGCACAATGAGG - Intergenic
1076408168 10:130227124-130227146 CCTCAGAGCAGGACTGCATTTGG - Intergenic
1076865313 10:133163750-133163772 TCTCATGGCAGGTCCCCATTAGG - Intronic
1077462686 11:2718435-2718457 CCTCAGAGCTGTGCCCCATGAGG - Intronic
1077606482 11:3616125-3616147 GCTCTGACCAGGGCCCCAGCAGG - Intergenic
1078315399 11:10289655-10289677 GCTCTGAGCAGGGCCGCCTAGGG - Intronic
1078339590 11:10489286-10489308 GCTCAGGGCAGGGCTGCATCGGG - Intronic
1078709476 11:13777004-13777026 GCTCAGAGTTGGGCACCATTGGG - Intergenic
1079517494 11:21286383-21286405 GCCCAGAGGTGGGCACCATTTGG - Intronic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1083822703 11:65181934-65181956 GCTCAGGGCAGGGCCCAACCAGG - Intronic
1084178633 11:67435916-67435938 GCCCAGAGCAGGTCCCCGTGCGG - Exonic
1084494716 11:69497262-69497284 GCTCAGAGCAGGGCCCTGGAAGG - Intergenic
1086344773 11:85884790-85884812 TCTCAGGCCAGTGCCCCATTTGG - Intronic
1086508962 11:87535040-87535062 GCTCAGGGCAGAGCCCAATAAGG - Intergenic
1086836862 11:91635703-91635725 GTTCAGTGTAGGCCCCCATTGGG - Intergenic
1087211012 11:95446598-95446620 GCTCAGAGGAGACCCACATTGGG + Intergenic
1089935381 11:122359163-122359185 AATTAGAGCAGGGCCCCATGGGG - Intergenic
1090213399 11:124939131-124939153 GCTCAGAATTGGGCCCCATGGGG - Intergenic
1090514714 11:127412583-127412605 GCTCAGGGCAGTGCCGCCTTGGG - Intergenic
1090825272 11:130380793-130380815 GCTCAGAGGAGGGCACCAATGGG + Intergenic
1091088397 11:132746015-132746037 GCTCAGAGCAGAGCCCTGCTGGG - Intronic
1091831021 12:3551317-3551339 GCTGAGGGCAGGGGCCCATCCGG + Intronic
1091991433 12:4959130-4959152 CTTCATAGCAGGGCTCCATTTGG + Intergenic
1092233427 12:6790907-6790929 GCTAAGAGCAGGGCCTGATGGGG + Intronic
1093059542 12:14588850-14588872 GCTCAGAGGAGAGCCGCAGTGGG + Intergenic
1096893918 12:54800603-54800625 GCTCAGAGCAGTGCGACCTTGGG + Intergenic
1097500298 12:60392810-60392832 GCTCAGAGAAGACCCACATTAGG - Intergenic
1098315229 12:69185620-69185642 GCTCAGAGCATGGCCCAAACAGG + Intergenic
1102439537 12:112950653-112950675 GCTCAGATCAGGGACCCTCTAGG - Intronic
1103959119 12:124596906-124596928 GCCAAGAGCTGGGCACCATTTGG - Intergenic
1106255480 13:28018877-28018899 GCTCAGGGGAGGGCCCCTGTTGG - Intronic
1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG + Intronic
1106654949 13:31733287-31733309 GCTCAGATGAGGGCCCCTGTGGG + Intergenic
1106762503 13:32880897-32880919 GCCCAGAGCTGGTCCCCATGGGG - Intergenic
1109082264 13:57919429-57919451 CCACAGAGCAGGGCACCAGTAGG - Intergenic
1110280263 13:73684888-73684910 GCTCAAAGCAGGGCCGGGTTGGG + Intergenic
1113637094 13:111927068-111927090 GAGCAGAGCAGGGTCCCAGTAGG + Intergenic
1113931540 13:113971491-113971513 GCTCAAGGCAGGGCCTCAGTGGG + Intergenic
1114972838 14:28055704-28055726 GCTGGCTGCAGGGCCCCATTGGG - Intergenic
1119514516 14:75237391-75237413 TCTCAGAGCAGGGCTCCACATGG + Intergenic
1120206394 14:81591442-81591464 TCTCACAGCAGGGCACCATGTGG + Intergenic
1121801927 14:96781694-96781716 GGTCAGAGCAGGCTCCAATTTGG + Intergenic
1122638663 14:103143505-103143527 GCTCCAAGTAGGGCCACATTGGG - Intergenic
1123933169 15:25181642-25181664 ACACAGAGCAGGGCCGCACTTGG - Intergenic
1123935599 15:25192580-25192602 ACACAGAGCAGGGCCACACTTGG - Intergenic
1124070481 15:26388376-26388398 GCACAGGGCAGGGTGCCATTGGG - Intergenic
1124717968 15:32084480-32084502 GCAAAGAGCAGAGCCCCTTTAGG + Intronic
1124805520 15:32878118-32878140 GCTCAGAGCATGGGCCTATCTGG + Intronic
1126379967 15:48036447-48036469 GCTTAGATGATGGCCCCATTTGG - Intergenic
1126497285 15:49306088-49306110 GTTCGGAGAAGGGCCACATTTGG + Intronic
1128185652 15:65641691-65641713 GCTCTGGCCAGGGCCCCATGAGG + Intronic
1129963286 15:79709607-79709629 GCTCAGGGCAGGGCCCCCCAGGG + Intergenic
1131367890 15:91854620-91854642 GCTCAGGCCAGGGCCACACTAGG - Intronic
1132603246 16:783144-783166 CTGCAGAGCAGGGCCCCAGTGGG - Intronic
1132800789 16:1751942-1751964 GCACCAAGCAGGGGCCCATTAGG - Intronic
1134095053 16:11413527-11413549 GGTCAGGGCATGGCCCCATGTGG + Intronic
1138204814 16:55116825-55116847 TTTCAGACCAGGGCACCATTGGG + Intergenic
1138343059 16:56303341-56303363 GGTCAGAGGAGAGCCCCATGTGG + Intronic
1139498945 16:67344649-67344671 TCTCAGGGCAGTGCACCATTAGG - Intronic
1141299638 16:82802059-82802081 GCTCAGAGCTGTGCCCCACTGGG + Intronic
1141709949 16:85692591-85692613 GCTCAGAGCTGGACCAGATTGGG - Intronic
1142247643 16:88977159-88977181 GCGCAGGGCAGGGCCCCAGATGG - Exonic
1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG + Intronic
1142474106 17:179864-179886 GGTTAGAGCAGGGCCCCTGTAGG - Intronic
1142594361 17:1022358-1022380 GCTCAGGGCTGGGTCCCCTTGGG + Intronic
1143499480 17:7330426-7330448 GCTGAGAGCAGCCCCCCAGTGGG + Intergenic
1144886504 17:18466749-18466771 GCCCAGAGCCTGGCACCATTGGG + Intergenic
1145006018 17:19338254-19338276 GCCCAGAGCAGGGCACCATCAGG - Intronic
1145145704 17:20477559-20477581 GCCCAGAGCCTGGCACCATTGGG - Intergenic
1145259988 17:21348976-21348998 GGTCAGAGCAGGGGCCCATGGGG - Intergenic
1145316629 17:21738962-21738984 GGTCAGAGCAGGGGCCCATGGGG + Intergenic
1150644231 17:66968275-66968297 CCTCAGAGCTGGGCTCCACTGGG - Intronic
1152381604 17:79945156-79945178 GCCCAGGGAAGGGCCCCAGTGGG - Intronic
1152736030 17:81997204-81997226 GCACAGAGCAGGGCCGCCCTGGG + Intronic
1154122663 18:11664350-11664372 GCTCAGAGCGTGGGCACATTGGG + Intergenic
1154165539 18:12011749-12011771 GCTCAGAACTGGCCCCCATGGGG + Intronic
1157006382 18:43589425-43589447 GCTCAGAGGAGAGCCACAGTGGG + Intergenic
1159811779 18:73025637-73025659 GCACAGAGCAGGGCGCCCCTGGG - Intergenic
1160350925 18:78177607-78177629 TCCCAGAACAGAGCCCCATTTGG + Intergenic
1160862420 19:1243152-1243174 GCTGAGAGCAGGGTCCCCTCTGG - Intronic
1161438627 19:4278715-4278737 GCACAGAGCAGAGCCCTCTTGGG + Exonic
1161580282 19:5077146-5077168 GCTCACAGCAGGGCACTATGGGG + Intronic
1161668841 19:5593112-5593134 GCTCACAGCAGTGCTCCTTTTGG - Intronic
1161770451 19:6228070-6228092 GCTCAGAGCAGGGACCCTAGGGG - Intronic
1162058635 19:8081143-8081165 GCTCAGGGCAGGGCCCAGTGGGG + Intronic
1162556625 19:11390588-11390610 TCCCAGAGCAGGCGCCCATTGGG - Intronic
1164537164 19:29094338-29094360 GATGAGAGCAAGGCCCCATGAGG - Intergenic
1164678944 19:30121289-30121311 CCCCAGAGGAGGGCTCCATTAGG - Intergenic
1166140590 19:40803167-40803189 GCTCAGAGCAGTGTCCCATCTGG - Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
925183403 2:1831220-1831242 CCTCAGAGCAGAGCTCCATCTGG - Intronic
925355712 2:3239641-3239663 GCTGAGGGCAGGGCCACATGTGG - Intronic
925355731 2:3239715-3239737 GCTGAGGGCAGGGCCACATGTGG - Intronic
927789679 2:26000587-26000609 GCTGGGAGCAGGTCCCCAGTTGG + Intergenic
929014619 2:37481971-37481993 GCTCAGAGCAGACCTCCATTGGG - Intergenic
932001796 2:67892047-67892069 GTTCAAGGCAGGGCGCCATTGGG - Intergenic
932297206 2:70636201-70636223 GCTCAGAACTGGGCAGCATTGGG + Intronic
944586722 2:201179303-201179325 GCTCAGAGGAGGCCCACAGTGGG - Intergenic
948605019 2:239129479-239129501 GCCCAGAGCAGGGGGCCACTGGG - Intronic
948839506 2:240642145-240642167 CCTCACAGCAGGGCCCGCTTGGG - Intergenic
1168747724 20:258462-258484 GCTCACAGCAGGGGCCTCTTCGG - Intronic
1168956800 20:1840240-1840262 GGTCAGAGCAGGGCTCCATGTGG + Intergenic
1172441830 20:34971503-34971525 CCTCAGAGCTGGGGCCCACTTGG + Intergenic
1172914504 20:38433772-38433794 GCTCAGTGCAGGGTTCCATGAGG - Intergenic
1173645341 20:44629709-44629731 GCTCAGGGGAGGGGCCCAGTGGG + Intronic
1173859095 20:46270362-46270384 ACTGTGAGCAGGGCCCCATCTGG + Intronic
1174037700 20:47678441-47678463 GCTCAGAGAAGGTCCCCAACTGG + Intronic
1180140118 21:45888146-45888168 GCTCAGAGCAGGGCTCAGCTAGG - Intronic
1181440334 22:22932353-22932375 GTTCAGAGCTGTGCCCAATTGGG + Intergenic
1181557086 22:23677405-23677427 GCTCAGAGCAGGGGCCCAAAGGG + Intergenic
1181697290 22:24600135-24600157 GCTCAGAGCAGGGGCCCAAAGGG - Intronic
1182471005 22:30548224-30548246 GCTGGGAGCAGGGACCCAGTGGG - Intergenic
1183512359 22:38243637-38243659 GCCCTGAGCAGGTCCCCATCTGG + Intronic
1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG + Intergenic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
1185147194 22:49144879-49144901 GCTCAGGCCAAGGCCTCATTGGG + Intergenic
1185214675 22:49591626-49591648 GCTGAGAGGAGGGATCCATTCGG - Intronic
1185397938 22:50601924-50601946 GCTCAAGGGAGGGCCTCATTAGG + Intronic
949943594 3:9173122-9173144 GCTCAGAGCTGGGCCAGATGTGG - Intronic
951350484 3:21601689-21601711 GCACAGAGCAGGGCATCTTTGGG - Intronic
952964056 3:38610281-38610303 ACTCAGAGCATGACCCCCTTTGG + Intronic
953581004 3:44156608-44156630 GCTCTGAGGAGAACCCCATTGGG + Intergenic
954193828 3:48984205-48984227 GCTCTGAGCAGGGTCACATTTGG + Exonic
956307802 3:67845568-67845590 GCTGAGAGGAGGGGTCCATTCGG + Intergenic
957610705 3:82461677-82461699 GCTCTTAGCAGGGCCCCTCTTGG - Intergenic
957636389 3:82790985-82791007 GCTCAGAGGAGGCCCACAATGGG - Intergenic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
962646387 3:137444955-137444977 TCTCACAGCAGTGCCCCAGTGGG + Intergenic
965984608 3:174736398-174736420 GCTCAGAGAAGACCCACATTGGG + Intronic
967828169 3:193895428-193895450 GCACAGAGGAGGGCCCTAATTGG - Intergenic
968740985 4:2331703-2331725 GCTCAGAGCAAGTCCCCACAGGG + Intronic
969927161 4:10595531-10595553 GCTGAGTGCTGGGCCCCACTTGG - Intronic
983651512 4:170040851-170040873 GCTCAGAGGAGAGCCACAGTGGG - Intergenic
984512287 4:180693480-180693502 GCTCAGGCCATGGCCCCATAGGG - Intergenic
985719790 5:1482798-1482820 CCTCAGAGCAGTTCCCCATGGGG - Intronic
986221050 5:5769038-5769060 GCCCAGAGCATAGCCCCATGCGG - Intergenic
986579729 5:9252816-9252838 GCTCAGAGCAGGGACACCCTGGG + Intronic
997381330 5:133440427-133440449 GCTCAGTGCAGCCCCACATTAGG - Intronic
999371702 5:151059415-151059437 GCCCAGTGCAGGGCCCCCTCAGG - Intronic
1001288120 5:170438315-170438337 GCTCAGAGCAGGGCCCACTCTGG + Intronic
1002191119 5:177478174-177478196 CCTCAGTGCAGGGCCCCACATGG - Intergenic
1002519466 5:179783215-179783237 GGTCATAGCAGAGCCCCATATGG - Intronic
1003070527 6:2942048-2942070 GCTGAGAGGAGGGGTCCATTTGG + Intergenic
1003377705 6:5594736-5594758 GCTCAGAGGAGGGACCCGTGGGG + Intronic
1004939539 6:20541297-20541319 GGGCAGAGCAGGGCTGCATTTGG + Intronic
1006092298 6:31635202-31635224 GCACAGAGCCTGGCCCCATTCGG + Exonic
1007353115 6:41289666-41289688 GCTCAGAGGAGGGGCCCACATGG + Intergenic
1007679627 6:43625321-43625343 CCTCAGAGTCTGGCCCCATTGGG + Intronic
1010396594 6:75400008-75400030 TCTCAGAGCAGGAACCCATCTGG + Intronic
1011616934 6:89206017-89206039 GCTGTGGGCAGGGCCCCAGTTGG - Intronic
1012122415 6:95384696-95384718 GCTCAGAGGAGACCCACATTGGG - Intergenic
1012249059 6:96959685-96959707 GCTCACATCAGGGCCTCCTTGGG + Intronic
1013102114 6:106995867-106995889 GCTCAGAGCAGGGACACAGATGG + Intergenic
1019502214 7:1369955-1369977 CCACACAGCAGGGCCCCTTTTGG - Intergenic
1019622693 7:2000339-2000361 GCTCTGTGCAGGGCCGCAATGGG - Intronic
1022102534 7:27177036-27177058 GCTCAGGTCAGGGCCCCGTAGGG + Intronic
1023296252 7:38717798-38717820 GCTCAGAGCAGAGCTCCAGGGGG + Intergenic
1023727231 7:43156286-43156308 GGACAGAGCAGGCCCCCAGTAGG + Intronic
1027550173 7:79582769-79582791 GCTCTGAGCAGGGGTCCCTTGGG + Intergenic
1032089910 7:128906309-128906331 GCTCAGGGCAGGGTCCTCTTGGG + Exonic
1032092334 7:128917225-128917247 GCTCAGGGCAGGGTCCTCTTGGG - Intergenic
1033317856 7:140313275-140313297 GCTCAGAGCAGGGCCCAGGCAGG + Intronic
1033566806 7:142586792-142586814 GTTCAGAGTAGGGCCCAATGAGG + Intergenic
1035725591 8:1823561-1823583 GCTCAGAGCTGCGCCCCTTGGGG - Intergenic
1039182264 8:34880167-34880189 GCTCAGAGGAGGCCCGCAGTGGG + Intergenic
1048301464 8:133254460-133254482 GCTCAGCACAGGGCCCCATGTGG - Intronic
1049685994 8:143939581-143939603 GCTCAGCTCAGAGCCCCAGTCGG + Intronic
1055111740 9:72566631-72566653 GCTCAGAGCAGGGCTTCCTGTGG - Intronic
1058141234 9:101358431-101358453 GCTCAGAGCAGGGACACAGATGG + Intergenic
1059389338 9:113988968-113988990 GCTCAGAGCAGTACCCCATCAGG + Intronic
1060010300 9:120037900-120037922 GCACACAGCAGGGAGCCATTTGG + Intergenic
1060223842 9:121779609-121779631 CCTCAGAGCAGGGCCACGTTAGG - Intronic
1061012314 9:127962927-127962949 GCCCAGACCTGGGCCACATTAGG - Intronic
1061129885 9:128702880-128702902 GCTGAGAGAAGGGCCCCAAGCGG + Exonic
1061309281 9:129751852-129751874 GCTCAGCTCCGGGCCACATTCGG + Intronic
1061881655 9:133572069-133572091 TCTCTGAGCAGGGCCGCACTGGG - Intronic
1062054085 9:134461950-134461972 TCTCGGAGAAGGGCCACATTGGG - Intergenic
1186456168 X:9711849-9711871 GCTCAGAGCAGTGCCCCGGAGGG + Intronic
1188908946 X:35822275-35822297 GCTCAGAGCATGGGCCTTTTGGG - Intergenic
1189023929 X:37371314-37371336 GCTCAGAGGAGACCCACATTGGG - Intronic
1189969940 X:46407913-46407935 GCTCAGAGCCCTGCCTCATTCGG - Intergenic
1193467873 X:81869193-81869215 GCTCTGTGCAGGGCCTCCTTGGG - Intergenic
1197609496 X:128622922-128622944 GCTCAGAGGAGGCCCACATTGGG + Intergenic