ID: 1142304680

View in Genome Browser
Species Human (GRCh38)
Location 16:89278675-89278697
Sequence TGCCCCGCCCCCTTCTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 1, 2: 9, 3: 38, 4: 444}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142304680_1142304687 -4 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304687 16:89278694-89278716 GGCAGGGGCAGGAGACACAGGGG 0: 1
1: 1
2: 10
3: 110
4: 1032
1142304680_1142304689 0 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304689 16:89278698-89278720 GGGGCAGGAGACACAGGGGGTGG 0: 1
1: 1
2: 12
3: 116
4: 1128
1142304680_1142304694 28 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304694 16:89278726-89278748 GTGAGGCCGTCCTGGTGGACGGG 0: 1
1: 0
2: 0
3: 7
4: 114
1142304680_1142304686 -5 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304686 16:89278693-89278715 GGGCAGGGGCAGGAGACACAGGG 0: 1
1: 3
2: 90
3: 314
4: 1072
1142304680_1142304692 23 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304692 16:89278721-89278743 CTCTCGTGAGGCCGTCCTGGTGG 0: 1
1: 0
2: 2
3: 90
4: 2213
1142304680_1142304690 11 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304690 16:89278709-89278731 CACAGGGGGTGGCTCTCGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 397
1142304680_1142304693 27 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304693 16:89278725-89278747 CGTGAGGCCGTCCTGGTGGACGG 0: 1
1: 0
2: 0
3: 5
4: 125
1142304680_1142304685 -6 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304685 16:89278692-89278714 GGGGCAGGGGCAGGAGACACAGG 0: 1
1: 1
2: 16
3: 145
4: 1200
1142304680_1142304691 20 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304691 16:89278718-89278740 TGGCTCTCGTGAGGCCGTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
1142304680_1142304695 29 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304695 16:89278727-89278749 TGAGGCCGTCCTGGTGGACGGGG 0: 1
1: 0
2: 0
3: 16
4: 241
1142304680_1142304688 -3 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304688 16:89278695-89278717 GCAGGGGCAGGAGACACAGGGGG 0: 1
1: 1
2: 14
3: 108
4: 990

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142304680 Original CRISPR TGCCCCGCCCCCTTCTCCCT TGG (reversed) Intronic