ID: 1142304692

View in Genome Browser
Species Human (GRCh38)
Location 16:89278721-89278743
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2306
Summary {0: 1, 1: 0, 2: 2, 3: 90, 4: 2213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142304680_1142304692 23 Left 1142304680 16:89278675-89278697 CCAAGGGAGAAGGGGGCGGGGCA 0: 1
1: 1
2: 9
3: 38
4: 444
Right 1142304692 16:89278721-89278743 CTCTCGTGAGGCCGTCCTGGTGG 0: 1
1: 0
2: 2
3: 90
4: 2213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type