ID: 1142305063

View in Genome Browser
Species Human (GRCh38)
Location 16:89280202-89280224
Sequence GGCCGAGGTGAGACAGGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142305049_1142305063 22 Left 1142305049 16:89280157-89280179 CCTCGGGGCCGGCGAAGGCGTCC 0: 1
1: 0
2: 1
3: 9
4: 80
Right 1142305063 16:89280202-89280224 GGCCGAGGTGAGACAGGCCGCGG 0: 1
1: 0
2: 1
3: 19
4: 226
1142305055_1142305063 -2 Left 1142305055 16:89280181-89280203 CCCAGGGCACCGGCTCCACCTGG 0: 1
1: 1
2: 4
3: 32
4: 255
Right 1142305063 16:89280202-89280224 GGCCGAGGTGAGACAGGCCGCGG 0: 1
1: 0
2: 1
3: 19
4: 226
1142305051_1142305063 14 Left 1142305051 16:89280165-89280187 CCGGCGAAGGCGTCCGCCCAGGG 0: 1
1: 1
2: 1
3: 3
4: 60
Right 1142305063 16:89280202-89280224 GGCCGAGGTGAGACAGGCCGCGG 0: 1
1: 0
2: 1
3: 19
4: 226
1142305054_1142305063 1 Left 1142305054 16:89280178-89280200 CCGCCCAGGGCACCGGCTCCACC 0: 1
1: 0
2: 3
3: 43
4: 357
Right 1142305063 16:89280202-89280224 GGCCGAGGTGAGACAGGCCGCGG 0: 1
1: 0
2: 1
3: 19
4: 226
1142305057_1142305063 -3 Left 1142305057 16:89280182-89280204 CCAGGGCACCGGCTCCACCTGGC 0: 1
1: 1
2: 6
3: 32
4: 287
Right 1142305063 16:89280202-89280224 GGCCGAGGTGAGACAGGCCGCGG 0: 1
1: 0
2: 1
3: 19
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142305063 Original CRISPR GGCCGAGGTGAGACAGGCCG CGG Exonic
900385058 1:2406718-2406740 ACCTGCGGTGAGACAGGCCGCGG + Exonic
900707765 1:4090984-4091006 GGACCAGGTGAGGCAGGCCATGG - Intergenic
903286783 1:22282315-22282337 GGCCGAGGGAAGCCAGGCTGGGG + Intergenic
903330197 1:22593278-22593300 GGCGGAGGGGAGACAAGGCGTGG - Intronic
903367964 1:22816539-22816561 GGCAGAGATGGGACAGGCAGAGG - Intronic
904255392 1:29251427-29251449 GGCCGAAGTGAGATAGTCTGGGG + Intronic
904611367 1:31727922-31727944 GCCCTTGGTGAGACAGGCTGGGG + Intronic
904811406 1:33165455-33165477 GACCAAGGTGAGCCTGGCCGGGG - Exonic
905694932 1:39967203-39967225 GGCTGAGGTGACATAGGCTGTGG + Intronic
907462137 1:54611478-54611500 GGCCGGGGTGGGACAGGAGGCGG - Intronic
916660745 1:166920769-166920791 GGCCGCGGTAGGACGGGCCGCGG + Exonic
916802222 1:168226136-168226158 GTCCGAGGTGAGTGAGCCCGGGG + Exonic
921692474 1:218165687-218165709 GGCCGAGGAGAAACAGCCAGAGG + Intergenic
922343450 1:224676342-224676364 GGACGGGGTGAGACATGGCGGGG + Intronic
1063339956 10:5253634-5253656 GGCTGAGGTGGGGCAGGCCTGGG + Intergenic
1065231088 10:23599082-23599104 GGGCGAGCTGAGGCAGGGCGGGG - Intergenic
1067848166 10:49739073-49739095 GGCAGAAGGGAGACAGGCAGGGG - Intronic
1068788368 10:61001510-61001532 GGCCGAGGTGGGAGAGGGCGGGG - Intergenic
1069604817 10:69732444-69732466 AGACAAGGTGAGACAGGCCGGGG + Intergenic
1069661632 10:70127122-70127144 GGCAGTGATGAGGCAGGCCGTGG + Intronic
1069867817 10:71514519-71514541 GGCCAAGGAGAGGCAGGCAGCGG - Intronic
1070610144 10:77927034-77927056 GGCCCCGGTGAGCCGGGCCGGGG - Intergenic
1071269755 10:83996107-83996129 AGCCAAGGTGAGACAGGAAGAGG - Intergenic
1076712421 10:132345693-132345715 GGCCGAGGAGAGATAGGACCAGG + Intronic
1076876720 10:133219910-133219932 GGCCGGGGAGAGACAGGGCGTGG - Intronic
1077122246 11:914981-915003 GGCCTAGGAGTGACAGGACGTGG - Intronic
1077415832 11:2423881-2423903 GACCGAGGTCAGCCAGGCTGGGG - Intergenic
1077609056 11:3633013-3633035 GGGCTAGGTGAGACAGGTTGGGG - Intergenic
1079387619 11:19994791-19994813 GGCTGAGGAGAGACAGCCCTGGG - Intronic
1080743309 11:35085120-35085142 GACTGAGGAGAGACAGGCTGTGG + Intergenic
1082810018 11:57474126-57474148 GGCCATGGTGAGTCAGGCTGAGG + Intronic
1082860173 11:57848000-57848022 GGGCGAGCTGAAACAGGGCGGGG + Intergenic
1083159761 11:60847852-60847874 GGCCGAGAGGAGACAGGGCATGG + Intronic
1083824044 11:65188319-65188341 GGCCGGGGGAAGACAGGCCAGGG + Intronic
1088257674 11:107916411-107916433 GGCCGAGGTGATACAGGAGGGGG + Intronic
1089338976 11:117744902-117744924 TGCTGGGGTGAGACAGGCCCTGG - Intronic
1089985909 11:122813648-122813670 GGGAGAGATGAGACAGGCAGAGG + Exonic
1090668552 11:128930723-128930745 GGCCGGGGTTAGGGAGGCCGGGG + Intergenic
1090668559 11:128930738-128930760 GGCCGGGGTTAGGGAGGCCGGGG + Intergenic
1090668579 11:128930783-128930805 GGCCGGGGTTAGGGAGGCCGGGG + Intergenic
1090668599 11:128930828-128930850 GGCCGGGGTTAGGGAGGCCGGGG + Intergenic
1090668606 11:128930843-128930865 GGCCGGGGTTAGGGAGGCCGGGG + Intergenic
1090668634 11:128930905-128930927 GGCCGGGGTTAGGGAGGCCGGGG + Intergenic
1090668641 11:128930920-128930942 GGCCGGGGTTAGGGAGGCCGGGG + Intergenic
1094494198 12:30979311-30979333 GGCAGAGCTGAGAGAGGCTGGGG - Intronic
1096613327 12:52817247-52817269 GGCTGAGGTGAGGCAGCCGGGGG - Intergenic
1096880616 12:54666061-54666083 GGCCAAGGTGAAACTGGCCCAGG + Intergenic
1097185193 12:57192964-57192986 TGCCGAGGTGAGAGAGGCGGGGG + Exonic
1102449038 12:113026800-113026822 GGCCAAGATGAGACAGCCAGAGG - Intergenic
1104655022 12:130567932-130567954 GGCATAGGTAAGACAGGCCAAGG - Intronic
1104958636 12:132477785-132477807 GGTAGGGGTGAGAGAGGCCGAGG + Intergenic
1105564493 13:21530803-21530825 GGCCGAGGCCAGGCAAGCCGTGG + Intronic
1107779182 13:43879770-43879792 GGGCGAGGTGAGGCGGGGCGAGG + Intronic
1108689152 13:52846801-52846823 GGCCGAGGTGGGCCGCGCCGGGG - Exonic
1108727913 13:53201616-53201638 GGCCGAGGTGGGCCGCGCCGGGG + Intergenic
1112049603 13:95632485-95632507 AGCCGAGGTGAGAGAGACGGGGG - Intronic
1113466796 13:110518734-110518756 GGCCGGAGTGAGACACGCCCAGG - Intergenic
1113707063 13:112441847-112441869 GGCAGAGGTGCGTCAGGCCATGG - Intergenic
1115641256 14:35337002-35337024 GGCCGGGAGGAGACAGGCCTGGG - Intergenic
1118184532 14:63524765-63524787 GGGAGAGGTGTGGCAGGCCGTGG - Intronic
1119404670 14:74390198-74390220 GGCCCAGGTGATAAGGGCCGCGG - Intergenic
1121452469 14:94017872-94017894 GGAGGAGGTGAGACAGGAAGTGG - Intergenic
1122194503 14:100074893-100074915 GGCTGAGGGGAGACAGGGTGGGG + Intronic
1122365756 14:101194039-101194061 GGCCTGGGGCAGACAGGCCGGGG - Intergenic
1122686852 14:103512738-103512760 GGCCGAAGGGAGTCAGGCCTGGG + Intergenic
1124360211 15:29031378-29031400 GGCCAAGGAGAGACGGCCCGAGG - Intronic
1125201052 15:37100986-37101008 GGCAGAGGAGAGGGAGGCCGCGG - Intronic
1127996084 15:64153759-64153781 GGCCCAGGCCAGACAGGCCCAGG - Intronic
1130256947 15:82330157-82330179 GGGCCAGGTGAGCCAGGCTGCGG + Intergenic
1130598001 15:85259831-85259853 GGGCCAGGTGAGCCAGGCTGCGG - Intergenic
1132708000 16:1254777-1254799 GGCCCAGGTGAGTCAGGAGGTGG + Intergenic
1132746322 16:1437801-1437823 GTCCGAGGTGCGCCAGGCAGCGG - Exonic
1132789565 16:1678181-1678203 GGCCGCGCTGAGATAGGCTGCGG + Intronic
1132879005 16:2153039-2153061 GGCCAAGGTGAGTCAGGGCAGGG + Exonic
1132913117 16:2325994-2326016 ATGCGAGGTGAGACATGCCGGGG - Exonic
1138599439 16:58046128-58046150 GTCCGTGGTGAGGCAGGCCCAGG - Exonic
1139589657 16:67926570-67926592 GGCTGAGATGAGGCAGCCCGGGG + Intronic
1140192489 16:72829763-72829785 GGCGGAGGTGAGAAAGACCAGGG - Exonic
1140915181 16:79487014-79487036 GGTCGAGGTGAGAGAGGTTGGGG + Intergenic
1141361264 16:83397112-83397134 GGCCGAGGAGGGACATGCTGGGG - Intronic
1141735632 16:85850579-85850601 GGCAGAGGTGACGCAAGCCGGGG + Intergenic
1142018705 16:87766453-87766475 GGCCGGGGTATGTCAGGCCGGGG - Intergenic
1142086141 16:88183587-88183609 GACCGAGGAGAGACAGGTGGTGG + Intergenic
1142179187 16:88659017-88659039 GGTGGAGGGGAGGCAGGCCGCGG - Intronic
1142305063 16:89280202-89280224 GGCCGAGGTGAGACAGGCCGCGG + Exonic
1142310874 16:89312798-89312820 GCCTGAGGTGGGACACGCCGAGG + Intronic
1142434514 16:90047856-90047878 GGCCGCGGTGAGATGGGGCGGGG + Intergenic
1143150860 17:4807124-4807146 GGCCGAGGCGGGGCCGGCCGAGG - Exonic
1143880250 17:10024450-10024472 AGCAGAGGTGACACAGGCCCGGG + Intronic
1144726094 17:17503554-17503576 GGCCGCGGTGGGACAGGCTCTGG + Intergenic
1147124034 17:38353026-38353048 CGGGGAGGTGAGACCGGCCGGGG + Exonic
1148122418 17:45221181-45221203 GGTCGAGGTGGGACAGGTGGCGG + Intergenic
1148624040 17:49055330-49055352 GGATGGGGTGAGACAGGCCAGGG - Exonic
1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG + Intergenic
1148868813 17:50643557-50643579 GGCCTTGGTGAGTCAGGCAGTGG - Intronic
1151308451 17:73279003-73279025 GGTCGAGGGGAGCCAGGCAGGGG + Intergenic
1152406622 17:80101619-80101641 CGCGGAGGTGAGCCGGGCCGGGG + Intergenic
1152525088 17:80883966-80883988 TCCCGAGGTGAGTCAGGCGGGGG + Exonic
1157101645 18:44735729-44735751 GGCGTAGGTGAGACAGGAAGGGG - Intronic
1160524455 18:79526774-79526796 AGCCGCCCTGAGACAGGCCGGGG + Intronic
1160861152 19:1237704-1237726 GGCGGACGGGGGACAGGCCGGGG - Intronic
1161470707 19:4455637-4455659 AGCCCAGGGGAGACAGGCCACGG - Intronic
1161478607 19:4499625-4499647 GGCCGAGGAGAAGCTGGCCGGGG + Exonic
1161939798 19:7395241-7395263 GGCCGAGGTGAGGACGGCGGCGG + Intronic
1162019818 19:7863274-7863296 GGCCGAGGTGAGCCGGCGCGGGG + Exonic
1162462356 19:10820625-10820647 GGCCGAGGTGGGGAAGGCAGCGG + Intronic
1163267099 19:16227967-16227989 GGGCCAGGGCAGACAGGCCGAGG - Intronic
1163654625 19:18538529-18538551 GGCAGAGGGGAGACAGATCGGGG - Intronic
1165044511 19:33094061-33094083 GGCCCAGGCAAGACAGGCCTAGG + Intronic
1165363807 19:35351947-35351969 GACCCAGGTGACACAGGACGAGG - Exonic
1165448315 19:35868777-35868799 GGCCGAGGTGAGGCCGGGCCGGG + Exonic
1165897451 19:39151376-39151398 GGCCGAGGGGAGATAGGCCCTGG + Intronic
1166011265 19:39944513-39944535 GGACCAGGTGAGGCAGGCCCTGG - Intergenic
1167245512 19:48370864-48370886 GGCCCAGGTGAGAAAGGCTGAGG - Intronic
1167824565 19:51960632-51960654 GCCGGAGGTGAGACATGCTGGGG - Intergenic
1168269764 19:55243122-55243144 GGCCGAGGTGGGGCCGGGCGCGG + Intronic
925331311 2:3060865-3060887 AGCTCAGGTGAGGCAGGCCGGGG - Intergenic
925348105 2:3184350-3184372 TGCCGAGGTAAGTCAGGCCCCGG + Intergenic
926165155 2:10517916-10517938 GGCAGAGGGGAGACTGGCTGTGG + Intergenic
928986323 2:37185916-37185938 GGCTCAGCTGAGACAGGCCCAGG - Intronic
929107295 2:38377384-38377406 GGGCGAGGAGATACAGGCGGAGG - Intergenic
929107300 2:38377405-38377427 GGGCGAGGAGATACAGGCGGAGG - Intergenic
933354497 2:81195948-81195970 GGCGGAGGGTAGACAGGCTGTGG + Intergenic
934735860 2:96689485-96689507 GGCCGAGGTGCACCAGGCCAAGG + Intergenic
934993174 2:98935841-98935863 GGCGGAGGTGGGGCGGGCCGGGG - Intronic
935211883 2:100945599-100945621 GGCCCAGATGAGAGAGGCCTCGG - Intronic
936092445 2:109510195-109510217 GGCTGAGGTGAGAATGGCCAGGG + Intergenic
936370462 2:111898530-111898552 GGCCGAGCCGAGGCCGGCCGGGG - Exonic
937244728 2:120485275-120485297 GGCCCAGGAGAGGCAGGCCAGGG + Intergenic
941997528 2:171614555-171614577 GGCTGAGGTGAGAGAGGTTGAGG + Intergenic
946635018 2:221715438-221715460 GGCAAAAGTGAGACAGGCTGGGG + Intergenic
1169800457 20:9507597-9507619 GGACCAGGGGAGAGAGGCCGGGG + Intergenic
1171438244 20:25140468-25140490 GGCCAAGGTGAGACAGCTCCAGG + Intergenic
1171451408 20:25238526-25238548 GGCCGTAGTGACACAGGCTGAGG + Intergenic
1171460278 20:25294188-25294210 GCCCGAGCTGAAGCAGGCCGTGG + Exonic
1172062623 20:32196792-32196814 GGCTGAGGTGAGGCGGGCTGGGG + Exonic
1172848733 20:37945245-37945267 GGGGGAGGTGGGAGAGGCCGAGG + Exonic
1175466267 20:59192696-59192718 GGCCCTGGTCAGACAGGCCGCGG + Exonic
1175856306 20:62122638-62122660 GGCCGGGGTGCGTCGGGCCGCGG - Exonic
1175995515 20:62810559-62810581 GGTCGAGGTGAGCCAGGCCTTGG + Exonic
1176140237 20:63541766-63541788 GCCCCAAGTGAGACAGGGCGAGG + Intronic
1176142238 20:63549876-63549898 GGTGGGGGTGAGACACGCCGGGG - Intronic
1180869612 22:19138793-19138815 GGCTGGGGTGGGACAGGCCCTGG - Intronic
1181012865 22:20052603-20052625 GGCCAAGGTGAGACAGGGTGGGG + Intronic
1181012875 22:20052633-20052655 GGCCTAGGTGAGACAAGGTGGGG + Intronic
1181540882 22:23572781-23572803 GGCTGAGGAAAGAGAGGCCGTGG + Intergenic
1181550792 22:23638143-23638165 GGCTGAGGAAAGAGAGGCCGTGG + Intergenic
1182787265 22:32918088-32918110 GGCTGAGGGGAGTCAGGCCTTGG - Intronic
1183188417 22:36305914-36305936 GGCAGAGGTGAGCCAGGGCCCGG - Exonic
1183252871 22:36742821-36742843 GGCAGAGGAGGGACAGGCAGGGG + Intergenic
1183308374 22:37096099-37096121 GGCAGAAGTGAGAGAGGCCAGGG + Intronic
1183349195 22:37325171-37325193 GGGGGAGGTGGGAGAGGCCGCGG + Intergenic
1183439662 22:37816045-37816067 GGCAGAGGGGAGCCAGGCAGGGG - Intronic
1183467083 22:37985216-37985238 GGCCAAGGTGGGACAGGTTGGGG + Intronic
1185059246 22:48597473-48597495 GGCCCAGGTGATGCAGGCCATGG - Intronic
950184234 3:10935193-10935215 GCCCGAGGTGAGACCGCCCCAGG + Exonic
952851999 3:37737239-37737261 AGCTGAGGAGAGACAGGCCCAGG + Intronic
954025739 3:47781816-47781838 GGCCGGGGTGGGCCAGGCTGTGG - Exonic
954782960 3:53074038-53074060 GGCCCAGGTGAGCCAGGCTCTGG + Intronic
955420368 3:58730470-58730492 GTCCCAGGTGATAAAGGCCGGGG + Intronic
958796339 3:98710195-98710217 GGCCGAGGAGAGTCAGGACTAGG - Intergenic
961467641 3:127091262-127091284 GGCCGAGGTGACACAGCCAGTGG - Intergenic
962198485 3:133382458-133382480 GGCAGATGGGAGACAGGCCCAGG - Intronic
962201426 3:133403807-133403829 GGTGGGGGTGAGACAGGCTGTGG - Intronic
962753530 3:138451649-138451671 GGCCGAGGTGGGAGAGGACATGG - Intronic
963061705 3:141231738-141231760 GGCCGAACTGAGACGGGGCGCGG + Intronic
966378872 3:179323486-179323508 GGCCGAGGGGAGCCCGGCCAAGG - Intronic
966945279 3:184773440-184773462 GGCCGAGGGCAGGCGGGCCGGGG - Intergenic
967852531 3:194093202-194093224 TGCAGAGGTGGGAGAGGCCGCGG - Intergenic
968178243 3:196569296-196569318 GGCCAAGGTGAGAGAGCCCCGGG + Exonic
968230479 3:197002566-197002588 GCCGGAGGTGACCCAGGCCGCGG - Exonic
968231336 3:197006533-197006555 GGCCCAGGTGAGCCAGGGTGGGG - Exonic
968327821 3:197835732-197835754 GGCCGAGGTGAGACAGCCCAAGG + Exonic
968488558 4:877074-877096 GGCCAAGGTGAGAGAGCCTGTGG - Exonic
968569629 4:1332799-1332821 GGACGAGGTGCGCCAGGCCATGG + Exonic
968974085 4:3812004-3812026 GGCCCAGGTGAGACAGGATGTGG + Intergenic
970441302 4:16083216-16083238 GACCGAGGTGAGACTCGCCAGGG - Intronic
976367196 4:84245129-84245151 GGCTGAGGTGAGGCGGGCTGGGG - Intergenic
976824957 4:89250007-89250029 TGCCGAGGTGAGGCAGCCTGTGG + Exonic
977323781 4:95549592-95549614 AGCCGAGGCGAGACAGACCAGGG + Intergenic
979559616 4:122087612-122087634 GGCCCAGGTCAGACTGGCCCAGG - Intergenic
979832021 4:125315581-125315603 GGCAGAGGTGAAAAATGCCGAGG + Intergenic
985155673 4:186984846-186984868 AGCGGAGGTGAAACAGGACGAGG - Intergenic
985271245 4:188196915-188196937 GGCCGAGGGGAATCTGGCCGGGG + Intergenic
985540581 5:485701-485723 GACGCAGGTGAGACCGGCCGAGG + Intronic
985644996 5:1080626-1080648 GGCCGAGTGGAGACAGCCGGGGG + Intronic
986285323 5:6354589-6354611 GGCTGGGGAGAGACAGGCTGGGG + Intergenic
986285351 5:6354686-6354708 GGCTGGGGAGAGACAGGCTGGGG + Intergenic
992609798 5:78497363-78497385 AGCCCGGGTGAGAGAGGCCGGGG - Intronic
994056658 5:95424087-95424109 GGCTGAAGTGCGACAGGCTGAGG + Intronic
997302089 5:132813654-132813676 TGCCGGGGTGAGCCAGGCGGCGG + Exonic
997440690 5:133906826-133906848 GGCTGAGGTCAGAGAGGCCAAGG - Intergenic
998157752 5:139796026-139796048 GGCCGGGGCGGGACGGGCCGGGG + Intronic
1000622902 5:163505585-163505607 GGCCTAGGGGAGGCGGGCCGAGG + Exonic
1001552357 5:172612166-172612188 GGCCAAGCTGAGACAGGACAAGG - Intergenic
1006393571 6:33772812-33772834 TGCCGAGGTGAGCCAGCCTGTGG + Intronic
1006839988 6:37022480-37022502 GGCCGAGGTGGGGCAGGTGGAGG - Intronic
1006840031 6:37022642-37022664 GGCCGAGGTGGGACAGGTAGAGG - Intronic
1007177202 6:39905104-39905126 GGCAGAGGGGAGGCAGGCAGGGG + Exonic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1009952472 6:70413398-70413420 GGAGGAGGTGAGAGAGGCCGGGG + Exonic
1013109165 6:107051392-107051414 GGTGGAGGTGAGGCAGGCCTTGG - Intergenic
1018613272 6:165662824-165662846 GGCCGCGGAGGGGCAGGCCGCGG + Intronic
1019112080 6:169724465-169724487 GGCCGTGGGGAGCCAGGCGGCGG - Intronic
1019518848 7:1451643-1451665 GGCCGGGGTGAGGCAGGACACGG - Intronic
1019640194 7:2099231-2099253 GGTCCAGGTGAGACAGGCTGTGG - Intronic
1020006289 7:4785242-4785264 GGCCCAGGTGGGACAGGGCCGGG - Intronic
1020105749 7:5421493-5421515 GGCGGGGAGGAGACAGGCCGCGG + Intronic
1020279411 7:6642803-6642825 GGCTGAGGTGGGCCAGGCCAGGG + Intronic
1020281682 7:6653252-6653274 GGCCGAGGAGAGAGAGGAGGCGG + Exonic
1022101967 7:27174173-27174195 GGCAGAGGCGAGGCAGGCGGCGG - Exonic
1023959275 7:44913092-44913114 GGCCGAGGTGAGGCAGGTCCTGG + Intergenic
1024249688 7:47496672-47496694 GGCACAGGTGAGAGAGGCGGAGG + Intronic
1026192046 7:68137732-68137754 GGCAGATGTGAGAGAGGCAGAGG - Intergenic
1027050827 7:75020143-75020165 AGCAGAGGTGAGCCAGGCCCTGG + Exonic
1028762329 7:94509892-94509914 GGCCGAGGAGGGGCAGGCGGAGG + Exonic
1032643800 7:133798673-133798695 GTCTGAGGTCAGACAGGCCTGGG - Intronic
1032854757 7:135825122-135825144 AGCTGAGGTGAGACAGGAGGAGG - Intergenic
1034552488 7:151830402-151830424 GGCAGAGAAGAGAGAGGCCGAGG + Intronic
1035021698 7:155804359-155804381 GGCCGAGGTGTGAAAATCCGAGG + Intronic
1035395958 7:158534721-158534743 AGCCGAGGTGAAACATGCCCGGG - Intronic
1035686710 8:1528701-1528723 GACCGAGCTGAAACAGGCCCTGG + Intronic
1035987426 8:4450072-4450094 AGCAGAAGTGAGACAGGACGAGG - Intronic
1038408841 8:27342630-27342652 GGCAGAGGTGACACAGGGGGAGG - Intronic
1040306564 8:46214979-46215001 GGGCAAGTTGAGACAGGCAGAGG + Intergenic
1041393062 8:57364588-57364610 GGCTGAGGAAAGACAGGCCACGG + Intergenic
1043873811 8:85463743-85463765 GGCCGAGGGGAGCCGGGCGGCGG + Intergenic
1046915996 8:119678979-119679001 GGCCCAGCTGGGACAGGCTGGGG - Intergenic
1047693891 8:127384158-127384180 GGCAGAGGTGAGACAGTAGGGGG + Intergenic
1049178870 8:141210235-141210257 GGCCGAGGTGAGGAAGCCAGGGG + Intronic
1049639353 8:143707625-143707647 GGCCGGGGTGAGGCGGGGCGGGG - Intronic
1052861824 9:33442253-33442275 GGCAGAGGAGAGGCAGGCTGGGG + Intronic
1052964413 9:34329090-34329112 GACCGAGGTGAGAAAGGGCGGGG - Exonic
1057291689 9:93810863-93810885 GGCCGAGGGGAGACAGGTCTGGG + Intergenic
1057911081 9:99021179-99021201 GAGGGAGGTGAGACAGGCAGAGG - Intronic
1060265377 9:122108916-122108938 GGGCCAGGTGGGACAGGCCTTGG - Intergenic
1062485610 9:136773790-136773812 GGCCGAGGGGAGAGAGGACATGG - Intergenic
1062614632 9:137390837-137390859 AGCCGAGGAGAGAAAGGCCCGGG + Intronic
1203769869 EBV:44239-44261 GGCCGAAGGGAGACAGGCGAAGG + Intergenic
1189213008 X:39300574-39300596 GGCCAAGGTGATACAGGCTGAGG + Intergenic
1189694893 X:43654444-43654466 GGGCGAGGCGAGACGGGACGGGG - Intergenic
1189738714 X:44097130-44097152 GGCTGGAGTGAGACATGCCGGGG - Intergenic
1189976238 X:46463302-46463324 AGGCCAGGTGAGTCAGGCCGGGG + Exonic
1196755033 X:119150492-119150514 GGCCCAGGTGAGCCAGGTAGGGG + Exonic
1199721321 X:150544577-150544599 GGCCTCGGTGAGCCAGGCCCTGG - Intergenic
1202175940 Y:22099010-22099032 GGCAGACGTGAGACAGACTGAGG - Intergenic
1202215421 Y:22487374-22487396 GGCAGACGTGAGACAGACTGAGG + Intergenic