ID: 1142305122

View in Genome Browser
Species Human (GRCh38)
Location 16:89280437-89280459
Sequence CTCCAGCCCCGGCTCAGCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142305117_1142305122 -4 Left 1142305117 16:89280418-89280440 CCACTCCGTCCTTGACGTCCTCC 0: 1
1: 0
2: 0
3: 12
4: 224
Right 1142305122 16:89280437-89280459 CTCCAGCCCCGGCTCAGCGACGG 0: 1
1: 0
2: 3
3: 26
4: 185
1142305112_1142305122 29 Left 1142305112 16:89280385-89280407 CCTCTGAGGTGGAGATGGCGGCG 0: 1
1: 0
2: 2
3: 16
4: 583
Right 1142305122 16:89280437-89280459 CTCCAGCCCCGGCTCAGCGACGG 0: 1
1: 0
2: 3
3: 26
4: 185
1142305118_1142305122 -9 Left 1142305118 16:89280423-89280445 CCGTCCTTGACGTCCTCCAGCCC 0: 1
1: 0
2: 1
3: 19
4: 346
Right 1142305122 16:89280437-89280459 CTCCAGCCCCGGCTCAGCGACGG 0: 1
1: 0
2: 3
3: 26
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142305122 Original CRISPR CTCCAGCCCCGGCTCAGCGA CGG Exonic
900091141 1:921219-921241 CTCCAGCCTCAGCCCAGCGGCGG + Intergenic
901057477 1:6455383-6455405 CTCCAGCCCCGGGCCAGCACCGG - Intronic
902513701 1:16979242-16979264 ATCCAGCCCCAGCTCAGTGGAGG + Intronic
902871769 1:19317897-19317919 CTCCAGCTACTGCTCAGCGAGGG + Intronic
903072410 1:20732822-20732844 CTCCAGCCACGGCACTGGGACGG + Intronic
904343989 1:29856282-29856304 CTGCAGCCCTGGCTCAGAGCTGG - Intergenic
905815241 1:40945129-40945151 CTCGAGCCATGGCTCAGCCAAGG - Intergenic
906636225 1:47412396-47412418 CCCCAGCCCCAGCTCTGCAAAGG - Intergenic
912879131 1:113390958-113390980 CTCCGGCCCCGTCTCAGCCCGGG - Exonic
915290340 1:154879060-154879082 CTCGAGCCCGGCCTCCGCGATGG + Intergenic
922505135 1:226121859-226121881 CGCCCGCCCCTGCTCAGCGCTGG - Intergenic
1062971266 10:1651292-1651314 ATCGAGCCCTGGCTCGGCGAAGG + Intronic
1063112483 10:3048784-3048806 CTCCAGCCCAGTCTCAGGGCTGG - Intergenic
1065926024 10:30434323-30434345 CTCCAGCCGCGGCCCCCCGAAGG - Exonic
1066602834 10:37126017-37126039 CTGCAGCCCCGGCTCAGGCAGGG - Intronic
1067183092 10:44005277-44005299 CTCCTGCCCCAGCACAGCGTTGG - Intergenic
1067317288 10:45180627-45180649 CTGCAGCCCCAGCTCAGGCAGGG - Intergenic
1067318723 10:45198075-45198097 CTGCAGCCCCGGCTCAGGCAGGG + Intergenic
1069651414 10:70052726-70052748 CGCCAGCCCAGGCTCCGCGACGG - Intergenic
1069900064 10:71701978-71702000 CCCCAGGCGCGGCTCAGTGAAGG + Intronic
1069957433 10:72060653-72060675 CTCCAGCCCCGGCTCAGTTCAGG - Exonic
1070678617 10:78433320-78433342 CTCCAGCTCCAGCTCAGTGGGGG + Intergenic
1072687902 10:97549709-97549731 CTCGGGCCCCAGCTCAGGGAGGG - Intronic
1073323127 10:102627756-102627778 TTCCAGCCCTGGCTCAGAGCTGG + Intronic
1076871184 10:133195880-133195902 CTCCACCCCCAGCTCAGCGAGGG - Intronic
1076947185 10:133659444-133659466 TTCCAGCCCCGGCTCTGCAAAGG + Intergenic
1077273563 11:1693045-1693067 CCCCAGCCTCTGCTCAGCCAGGG - Intergenic
1077393373 11:2309856-2309878 ATCCAGCCCCGGCACTGCCAGGG - Intronic
1078050468 11:7961168-7961190 CTCCAGCTCCTGCTCCGGGAAGG + Exonic
1083679657 11:64345251-64345273 CTCCAGCCCCAGCTCAGTGCTGG - Intronic
1084189686 11:67493332-67493354 CTCCACCCCCGGATCGGCGGAGG - Intronic
1084587198 11:70069109-70069131 CCCCAGCCCATGCTCAGAGATGG - Intergenic
1089325046 11:117651210-117651232 CTCCAGCCTCAGCTCAGGGATGG + Intronic
1089578794 11:119468585-119468607 CTCCAGCCCTGGCTCCTGGATGG - Intergenic
1089683076 11:120130309-120130331 CTCCTGACCCAGCTCAGTGATGG + Intronic
1089779350 11:120862228-120862250 CTCCAGTCCCAGCTCAGAAAGGG + Intronic
1091012864 11:132022151-132022173 CTCCAGCCCCAGCTCAGTCATGG - Intronic
1091589391 12:1834450-1834472 CTCCGGCTCCGGCTCAGCCCCGG - Exonic
1092183037 12:6458998-6459020 CTCCTGCCCCAGCTCATCTATGG + Intronic
1092426375 12:8378909-8378931 CTGCAGCCCCGGCTTAGCTGGGG - Intergenic
1092637630 12:10468873-10468895 CTCCAGCCCAGGAACAGCAAGGG + Intergenic
1094018159 12:25885494-25885516 CTCCAGTCTGGGCTCACCGAAGG - Intergenic
1095258266 12:40067231-40067253 CTCCAGCCTGAGCACAGCGAAGG - Intronic
1096103960 12:48985960-48985982 CTCCAGCCAGGGCCCAGGGAGGG - Intergenic
1097794087 12:63844096-63844118 CTCCAGAGCCGGCGCCGCGAGGG - Intergenic
1098998674 12:77150872-77150894 CCCCAGCCCCCACTCAGCAATGG - Intergenic
1102259333 12:111434911-111434933 CTCCAGCCACGGCACAGCACCGG - Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103365132 12:120376624-120376646 CTCCAGCCCTAGCACAGTGATGG - Intergenic
1103394456 12:120597288-120597310 GTCCAGTCCCAGCTCAGTGAGGG - Intergenic
1103700876 12:122848195-122848217 CTCCTCCCCGGGCTCAGTGAGGG - Intronic
1104713183 12:130999359-130999381 CCCCTGCTCCGGCTCAGTGAAGG + Intronic
1105223839 13:18409079-18409101 CTGCAGCCCCGGCTCAGGCAGGG - Intergenic
1113566498 13:111322601-111322623 CTCCAGCCCAGGGTCAGCTTGGG - Intronic
1118334607 14:64842289-64842311 CTCCAGCCCTTGCTGAACGAAGG - Intronic
1119114256 14:72003908-72003930 CTCCAGCCAAGGGTCAGAGAAGG + Intronic
1119730826 14:76950239-76950261 CTCCAGCCCCGGACGAGCCAAGG - Intergenic
1120722515 14:87904247-87904269 CTCCATCCCCAGCCCAGTGATGG - Intronic
1122353835 14:101112044-101112066 CCCCAGCCCCAGCTCAGCCTGGG - Intergenic
1122685420 14:103502531-103502553 CTGCAGGCCCAGCTCAGGGAAGG - Intronic
1122856334 14:104561957-104561979 CTCCAGGGCCTGCCCAGCGATGG + Intronic
1202923659 14_KI270724v1_random:5583-5605 TTCCAGCCCTGGCTCTGCAAAGG - Intergenic
1124634709 15:31357630-31357652 CTCCAGACCCAGCTCAGAGTAGG - Intronic
1126110788 15:45173586-45173608 CTCCAGGCTGGGCTCAGGGAGGG + Exonic
1128315114 15:66655132-66655154 CTCCCGGCCCGGCTCCGCGCTGG + Intronic
1130305326 15:82709426-82709448 CTGGAGCCCCGGCCCAGCGCGGG - Intronic
1131367895 15:91854631-91854653 CTGCAGCCCCGGCTCAGGCCAGG - Intronic
1132111394 15:99104855-99104877 AGCCAGGCCGGGCTCAGCGAAGG - Intronic
1132637430 16:958970-958992 CAGCATCCCCGGCACAGCGAGGG - Intronic
1137290194 16:47047179-47047201 CTCCAGCCCCAGCTCCTTGAGGG - Intergenic
1138584494 16:57961097-57961119 GTCCAGCCCTGGCTCAGAAATGG - Intronic
1139651355 16:68363760-68363782 CCCCAGCCCCAGCTCACCGATGG + Exonic
1141093113 16:81143968-81143990 CTCCAGCCCTGACTCAGATAAGG + Intergenic
1141184606 16:81778725-81778747 CTCCAGCGCAGCCTCAACGAGGG + Intronic
1141689346 16:85587624-85587646 CTCCAGCCTCTGCTCAGTGATGG - Intergenic
1142213175 16:88817961-88817983 CTGCAGCCCCGGCAAAGAGACGG + Intronic
1142305122 16:89280437-89280459 CTCCAGCCCCGGCTCAGCGACGG + Exonic
1142890246 17:2938484-2938506 AGCCAGCCCCGGCTCAGCCCAGG - Intronic
1143029469 17:3959845-3959867 CTCCAGCTCCGGATAAGCCAGGG - Intronic
1143097587 17:4486599-4486621 CACCAGGCCCGGCTCAGGGCCGG + Intronic
1143733530 17:8894716-8894738 CCCCAGCCCCTGCTCTGTGAGGG - Intronic
1144756476 17:17682828-17682850 CGCCAGCCCGGGCTCCGCGCAGG - Intronic
1144930637 17:18856177-18856199 CTCCAGTCCCGGCGCAGGGATGG + Intronic
1147374816 17:40017190-40017212 CCCCAGCCCTGGCTCTGCAATGG + Exonic
1147400573 17:40178073-40178095 CTCCAGCCCCGGCTCGGCGGGGG - Intronic
1150048733 17:61938159-61938181 CTCCACCCCCAGCTCAGCTTGGG - Intergenic
1150613649 17:66752688-66752710 CTCCAGCCCCAGCAGAGCCATGG - Intronic
1151514361 17:74582680-74582702 CTCCAGAAGTGGCTCAGCGAGGG - Intronic
1154475266 18:14748649-14748671 CTGCAGCCCCGGCTCAGGCAGGG - Intronic
1154529466 18:15330035-15330057 CTGCAGCCCCGGCTCAGGCAGGG + Intergenic
1155007228 18:21740620-21740642 CTCCAGCCCCGCCTCCAGGACGG + Intronic
1155785611 18:29896370-29896392 CTCCAGCTCCAGCTCAGAGCAGG + Intergenic
1156325038 18:36067375-36067397 CTCCAGCGCCGCCTCAGAGAAGG + Exonic
1156482280 18:37443720-37443742 CCCCAGCCCCGACACAGAGAGGG - Intronic
1160916155 19:1497600-1497622 CTCCAGCCCGGTCTCACCCATGG + Exonic
1160985298 19:1835863-1835885 CTCCAGCCAGGGCTCAGCCCAGG + Intronic
1161228179 19:3157645-3157667 CAACAGCCCCGTCTCCGCGATGG + Intronic
1161480014 19:4505748-4505770 CTCCAGCACTGGCGCGGCGAGGG - Intronic
1162145222 19:8609278-8609300 CTCCAGCCCCTCCTCCCCGAAGG + Intronic
1163012594 19:14434692-14434714 CTCTACCCCCGGCCCAGGGAGGG + Intronic
1163470920 19:17496539-17496561 GGCCAGCCCAGGCTCAGCCAGGG + Intronic
1163668472 19:18613861-18613883 CTCCAGCCCCGCCTGGGGGAGGG - Exonic
1164226993 19:23254513-23254535 CTCCAGACCTGGCTCAGCTCTGG + Intergenic
1166373104 19:42313346-42313368 CTCCGGCCCCGGCTCCGCTCCGG - Exonic
1167070925 19:47221628-47221650 CTCCAGCCCCAGCCCAGCCTGGG - Exonic
926037402 2:9646346-9646368 CTCCCTCCCCTGTTCAGCGAGGG + Intergenic
927640264 2:24841412-24841434 CTCCAGCCCCTCCTCAGTGAGGG + Intronic
927960448 2:27237839-27237861 GTCCAGCCGCAGCTCAGAGAAGG - Exonic
928399959 2:30970738-30970760 CTCCAGCACAGGCCCAGGGAGGG + Intronic
928805874 2:35154103-35154125 CTACAGCCCCTGCACAGCAAGGG + Intergenic
929808583 2:45169608-45169630 CTCCAACCCGGGCTCAGCTTCGG - Intergenic
933690878 2:85178727-85178749 CTGAAGCCCTGGCTCAGCCATGG + Intronic
938528564 2:132161457-132161479 CTGCAGCCCCGGCTCAGGCAGGG + Intronic
943916697 2:193644122-193644144 CTCCAGCCCCTTCTCAGCCATGG - Intergenic
945706058 2:213233292-213233314 CTACAGCTCCGTCTCAGCAAAGG - Intergenic
946275819 2:218630818-218630840 CTCCAGCCCAGGCTCTGCTGTGG + Intronic
949059193 2:241947007-241947029 ATCCAGCTCGGGCTCAGGGATGG - Intergenic
1168996250 20:2135336-2135358 CACCAGCCCCTGCTCAGCAGGGG - Intronic
1169113078 20:3045801-3045823 CTCCAGCCCCCACGCAGGGAAGG - Intergenic
1170441763 20:16386431-16386453 CCCCAGCCCCAGCCCAGCAAAGG - Intronic
1170590102 20:17765263-17765285 CTCCAGGCCAGGCCCAGCCAAGG + Intergenic
1170597758 20:17818362-17818384 CTCCGGCCCTGGCTCAGTCACGG + Intergenic
1172859204 20:38033955-38033977 CTCCAGCGCCGACTCAGAGAAGG - Exonic
1173851396 20:46220627-46220649 CTCCAGCCCCCACTCAGAGCTGG - Intronic
1174056241 20:47800349-47800371 CACCAGGCCAGGCTCAGAGAGGG - Intergenic
1175926544 20:62474234-62474256 CTCCAGGCCCGGCCCGGCGCCGG + Intronic
1175965106 20:62656493-62656515 CCCCAGCCCCAACTCAGCCATGG + Exonic
1176767932 21:13038433-13038455 CTGCAGCCCCGGCTCAGGCAGGG - Intergenic
1177710026 21:24762236-24762258 CTCCATTCCCCGCTCAGAGAGGG + Intergenic
1179996589 21:44977139-44977161 CACCAGCGCCTGCTCAGGGACGG - Intergenic
1181267937 22:21642142-21642164 CTCCAGTCCCCGCCCAGCTACGG + Intergenic
1183222892 22:36528582-36528604 CCCCACCCCCTGTTCAGCGATGG - Intronic
1183246584 22:36698500-36698522 CTCCACGCTCGGCTCAGCCATGG - Intronic
1183606881 22:38871418-38871440 CCCCAGCCCCGGCACAGCACGGG - Intronic
1183736396 22:39647069-39647091 CCCCAGGCCCGGCCCAGCGCAGG - Intronic
1184977541 22:48073558-48073580 CTCCAGCCCTGCCTCAGTCACGG + Intergenic
1185085833 22:48740585-48740607 CTTCAGAACCGTCTCAGCGAAGG + Intronic
1185398432 22:50604108-50604130 CTCCAGCTCCGTCTCCGAGATGG - Exonic
949877277 3:8634530-8634552 CTCCAGCCCTGGCACACAGAGGG + Intronic
953159769 3:40407621-40407643 ATCCAGCCCCAGCTCATCTAAGG + Intronic
953694522 3:45146978-45147000 CTCCATCCACAGCTCAGTGAAGG - Intergenic
954354131 3:50070760-50070782 CTCCAGCCCTGGCTTTGGGAAGG - Intronic
957080270 3:75630972-75630994 TTCCAGCCCTGGCTCTGCAAAGG - Intergenic
961202451 3:125055732-125055754 CTCCAGCCCCGCTCCCGCGAGGG + Exonic
961787624 3:129357194-129357216 CGACAGCCCTGGCTCAGCCAAGG - Intergenic
962738886 3:138348739-138348761 CTCCAGCCCCGGCTCGGCTACGG - Intronic
964006799 3:151839575-151839597 CTCCAGCCTGGGCTGAGAGAGGG + Intergenic
964624854 3:158748998-158749020 CTCCAACCCCAGCCCAGCCATGG - Intronic
964737071 3:159928207-159928229 GTGCAGCCCAGGCTCAGAGATGG - Intergenic
967824747 3:193869366-193869388 CTCCAGGCCTGGCTCAGGGTGGG - Intergenic
967929296 3:194679155-194679177 CTCCAGCCCTGACTCACCGAGGG - Intergenic
968372829 4:11298-11320 CTCCCGCCCCGGCGCCGCGCCGG - Intergenic
971949961 4:33332281-33332303 CTCCAGCCTCGGTTCTGCAATGG - Intergenic
975394359 4:73857459-73857481 CTCCAACCCCAGGTCAGGGATGG - Intergenic
975679133 4:76858307-76858329 CTCCAGCCTCTGCTGAGCTAAGG - Intergenic
977693773 4:99946249-99946271 CCCCAGCCCCGGCTCCGGGCTGG - Intronic
985044836 4:185929937-185929959 CTCAAGCCTCAGCTCAGCCATGG + Intronic
985450645 4:190060243-190060265 TTCCAGCCCCGGCTCTGCAAAGG + Intergenic
986015569 5:3754433-3754455 CTCCGGCCCCAGCCCAGGGACGG - Intergenic
987294156 5:16535537-16535559 CTCCAGCTCCCACTCTGCGAAGG - Intronic
988540558 5:32104686-32104708 CTCCAGCCTGGGGTCAGAGAAGG + Intronic
990986751 5:61647939-61647961 TTCCAGCCCCTGCTCTGAGAGGG - Intronic
995047906 5:107671099-107671121 CGCCGGGCCCGGCTCAGCGTCGG + Intergenic
996796925 5:127357710-127357732 ATCCAGCCCCTGCTAAGTGATGG - Intronic
997349685 5:133221626-133221648 CTCCAGCTCTGGCACAGAGACGG - Intronic
998417465 5:141956134-141956156 GTCCAGCCTGTGCTCAGCGATGG - Exonic
999717207 5:154370877-154370899 CTCCAGACCAGGCTCAGCAGAGG + Intronic
1001822385 5:174720527-174720549 CTCCAGCCCCGGCTCAAACCCGG + Intergenic
1002136318 5:177110050-177110072 CTCCGGCTCCGGCTCCGGGAAGG + Intergenic
1003871702 6:10409547-10409569 CTCCACGCCAGACTCAGCGATGG + Intronic
1013232132 6:108168582-108168604 CTCCAGCCCCGGCTCAGGTCGGG + Intronic
1013375472 6:109509991-109510013 CCCCAACCCCTGCTCAGAGATGG - Intronic
1017012025 6:150069375-150069397 CTCCACCCCAGGCTCCGCGCGGG + Intergenic
1017766090 6:157608558-157608580 CTCCTGCCCGGGCTCAGCACAGG - Intronic
1018272383 6:162094166-162094188 CTGCAGCCCCAGCTCACAGATGG - Intronic
1019276943 7:180583-180605 GTCCAGCCCCGGCCAGGCGATGG - Intergenic
1019449392 7:1089280-1089302 CACCAGCCCCAGCTAAGTGAAGG + Intronic
1019474059 7:1235711-1235733 CTCCTGCCCCGGCCGAGCGGAGG + Intronic
1019577905 7:1746371-1746393 CACCAGCGGCGGCTCCGCGACGG - Exonic
1019729866 7:2623828-2623850 CTGGAGACCCGGCTCAGCGTGGG - Intergenic
1020257478 7:6510219-6510241 CTCCACCCCAGGCTCAGCCCTGG - Intronic
1021116777 7:16753747-16753769 CTCCTGCTCCGGCTCAGCTGCGG + Exonic
1022456791 7:30564766-30564788 CTCCAGACCCTGCTGAGGGAGGG - Intergenic
1025077018 7:55952144-55952166 CCCCCTCCCCGGCCCAGCGACGG - Intronic
1025236757 7:57239806-57239828 CACCAGGCCAGGCTCAGAGAGGG + Intergenic
1029073333 7:97917527-97917549 CTGCAGCCCCGGCTGAGCTGGGG - Intergenic
1029302741 7:99598170-99598192 CTCCAGCTCCAGCTCTGCGGAGG - Intronic
1029416276 7:100445121-100445143 CACCAGCCCCAGCTCTGTGAAGG + Intergenic
1031531882 7:122886218-122886240 CTCCAGCCCCGACTCGGGAAGGG - Exonic
1033583962 7:142760656-142760678 CTCCAGCCACAGCTCAGATATGG - Intronic
1034451051 7:151137491-151137513 CTCCAGCAGGGGCTCAGCCAGGG + Intronic
1034750319 7:153562196-153562218 CTGCAGCCCCTGCTTACCGAGGG + Intergenic
1035233467 7:157480884-157480906 GTCCTGCCCCAGCTCAGGGAGGG + Intergenic
1036244356 8:7103763-7103785 CTGCAGCCCCGGCTTAGCTGGGG + Intergenic
1036614719 8:10379449-10379471 CTCCAGCCCAGCCTCAGCCCGGG - Intronic
1036692083 8:10950383-10950405 CCCCAGCCCTGGCACAGGGAGGG - Intronic
1040408622 8:47133477-47133499 CTCCAGGCCCTGCTGAGCGGGGG + Intergenic
1043214957 8:77574223-77574245 CTCCCGCTCTGGCTCAGGGAAGG - Intergenic
1049238667 8:141525522-141525544 CTCCAGCCCCACCCCAGGGATGG - Intergenic
1049681872 8:143922555-143922577 CTCACGCTCCAGCTCAGCGATGG + Exonic
1053707181 9:40767797-40767819 CTGCAGCCCCGGCTCAGGCACGG + Intergenic
1054417094 9:64888565-64888587 CTGCAGCCCCGGCTCAGGCACGG + Intergenic
1056078151 9:83062574-83062596 CTCCGGCCCCGCCTCAGACACGG + Exonic
1056762732 9:89426518-89426540 CTCCAGCCAGAGCTCTGCGAAGG + Intronic
1057309480 9:93933187-93933209 CTGCAGACCCGGGTCAGGGAAGG - Intergenic
1057752405 9:97803487-97803509 CCCCAGGCCCGGCCCAGCGCGGG + Intergenic
1057832974 9:98420667-98420689 ATCCAGCCCAGGCTCACAGAGGG + Intronic
1059484553 9:114616858-114616880 CTCCAGCTCAGGCACAGCCAGGG - Intronic
1061422439 9:130479666-130479688 CTCTGGGCCCGGCTCAGCGGAGG - Intronic
1061541308 9:131278994-131279016 CAGCAGCACCGGCTCAGCCATGG + Intergenic
1062580313 9:137226526-137226548 ATCCAGACCTGGCTCAGCTAGGG - Intergenic
1186517711 X:10178739-10178761 CGACAGCCCAGGCTCAGCTATGG - Intronic
1189262595 X:39689068-39689090 CTCCCTCCCCGGCTCCGCGCCGG - Intergenic
1195569841 X:106385763-106385785 CTCCAGCACCTGCCCAGTGAGGG + Intergenic
1199180517 X:144848668-144848690 CTGCAGCCCCTGCCCAGCCAAGG + Intergenic