ID: 1142308096

View in Genome Browser
Species Human (GRCh38)
Location 16:89296864-89296886
Sequence CCCATTCCTGCCCTCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142308096_1142308101 -7 Left 1142308096 16:89296864-89296886 CCCCACCAGAGGGCAGGAATGGG 0: 1
1: 1
2: 1
3: 16
4: 256
Right 1142308101 16:89296880-89296902 GAATGGGTCAGAAGTCTCATTGG 0: 1
1: 0
2: 0
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142308096 Original CRISPR CCCATTCCTGCCCTCTGGTG GGG (reversed) Intronic
900269531 1:1779898-1779920 CGCATACCTGCTCTCTGGTCAGG + Exonic
900496508 1:2978389-2978411 CCCCACCCTCCCCTCTGGTGGGG - Intergenic
901454985 1:9358034-9358056 TGTATTCCTGACCTCTGGTGGGG - Intronic
903009539 1:20320016-20320038 CCCATTCCTGGCCCCTGGCCAGG - Intronic
903588270 1:24434009-24434031 TCCATTACTGCCCTCTTTTGTGG - Intronic
903915781 1:26763207-26763229 CCGGTTCATGCCCCCTGGTGGGG - Exonic
904195861 1:28784985-28785007 CCCAGTCATGGCCTCTGGGGTGG + Intergenic
904260237 1:29283789-29283811 CCCAGGCCTGCCTTCGGGTGGGG + Intronic
904424718 1:30415925-30415947 CACCTTCCTGCCCTGTGGGGTGG + Intergenic
904457750 1:30657611-30657633 CTCATTCCTGGCATGTGGTGGGG + Intergenic
904795767 1:33055300-33055322 CTCTTGTCTGCCCTCTGGTGGGG + Intronic
905148354 1:35905769-35905791 CCTATTCCTCCCTTCTGATGAGG + Intronic
905701613 1:40020430-40020452 CCAATTTCTCCCCTCTGATGTGG + Intergenic
906191267 1:43900914-43900936 CCCTTTCCTCCCCTTTGGGGAGG - Intronic
906383526 1:45347827-45347849 CCAAGTCCTGGCCTCTGGGGAGG + Intronic
906404925 1:45534324-45534346 CTAATTCCTGACCTCAGGTGGGG + Intergenic
907311963 1:53543933-53543955 CCCCTTCCTGCTCTCCCGTGTGG - Intronic
909016734 1:70388145-70388167 CCCTTTCCTGCACTGTGGTCTGG + Intergenic
909158015 1:72105443-72105465 GCAATTCCTGCACTTTGGTGGGG + Intronic
910909644 1:92219545-92219567 CCCATTCCTGCACTCCAGCGTGG - Intronic
912776233 1:112508126-112508148 CCCCACCCTGGCCTCTGGTGCGG + Intronic
912801073 1:112720057-112720079 CCCATTCCAGCCCTCTGGTGTGG + Intergenic
915450612 1:156002541-156002563 CCCAGTCCAGCACTTTGGTGGGG + Intronic
916133420 1:161631273-161631295 CCTATTCCTGTTCTATGGTGGGG - Intronic
917720447 1:177782006-177782028 CCCCTTCCTGCCACCTTGTGAGG - Intergenic
920586761 1:207171894-207171916 CCCATTCCTGATGTCTGGAGGGG - Intergenic
921776965 1:219112281-219112303 TGCATTCCTGCCCACTGGTGGGG - Intergenic
922028328 1:221774150-221774172 CCCTCTCCTGCCCTCAGGTCTGG - Intergenic
922505527 1:226123397-226123419 CCCAAGCCTGCCCACTGATGGGG + Intergenic
923544320 1:234913213-234913235 CCCTTTGCTGCCCTCTGTGGGGG - Intergenic
924292749 1:242554760-242554782 CCCACTCCTGACCTGTGGAGAGG + Intergenic
1063122673 10:3115560-3115582 CCCAGTCCTGTCCTCAGCTGAGG - Intronic
1063643489 10:7855371-7855393 GCCATCCCTGCCTTCTGGTCTGG - Intronic
1064995245 10:21291009-21291031 ACCATTACTGGCATCTGGTGTGG - Intergenic
1065698886 10:28405431-28405453 CCCACTCCTGCCCTCTGCACTGG + Intergenic
1066660909 10:37737560-37737582 CCAAGTCCTGCCCCGTGGTGAGG - Intergenic
1067552701 10:47246637-47246659 CATATTCCTGCCTTCTGGGGAGG - Intergenic
1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG + Intergenic
1070728215 10:78807015-78807037 CCCCTTCCTGCCCTCCACTGAGG + Intergenic
1070962862 10:80511220-80511242 CCCCTTCCTCGCATCTGGTGTGG - Intronic
1072674739 10:97457390-97457412 CCCTTCCCTGCCCTATCGTGAGG - Intergenic
1073363419 10:102918205-102918227 CCCATTCCAGCCCCCTGGCTGGG + Intergenic
1074974142 10:118566759-118566781 CTGAGTCCTGCCCTGTGGTGGGG + Intergenic
1075209362 10:120478046-120478068 CCCATTCCAGGGATCTGGTGGGG - Intronic
1075423478 10:122324004-122324026 CAAATTACTTCCCTCTGGTGAGG - Intronic
1076117653 10:127911640-127911662 GCCCTTCCTGCCCAGTGGTGGGG - Intronic
1076614908 10:131748898-131748920 CGCCTTCCTGTCCTTTGGTGAGG - Intergenic
1077197373 11:1288203-1288225 CCAATGCCTGCCCTGTGGGGAGG + Intronic
1077551974 11:3204477-3204499 GCCATCCCTGGCCTCTGCTGTGG + Intergenic
1079668465 11:23135962-23135984 CCCATTCCTCCCCACTGGGTGGG - Intergenic
1084957356 11:72698361-72698383 AGCATTCTTGCCCTCTGTTGTGG + Intronic
1085254907 11:75166941-75166963 CCTATCCCTGGCCTCTGGTCTGG - Intronic
1087138674 11:94744538-94744560 CACATACCTGACCTCTGGGGAGG - Intronic
1089134607 11:116239183-116239205 CCCCTTCCTGTCCTCTGGGGAGG - Intergenic
1089172647 11:116526118-116526140 CCCAGTCTGGCCCACTGGTGGGG + Intergenic
1089349587 11:117814805-117814827 CCCCCTCCTGCCCCCTGGGGCGG + Intronic
1089743219 11:120599402-120599424 CCCATGCCTGCCCTCTTCTCAGG + Intronic
1090621773 11:128566968-128566990 CACCTTCAGGCCCTCTGGTGAGG - Intronic
1091162584 11:133438750-133438772 CCCATCCCTGACCTCTGGGGAGG + Intronic
1094850070 12:34378387-34378409 CCCATGCATGCGCTGTGGTGAGG + Intergenic
1096870087 12:54587740-54587762 CCAACTCCTGCCCTTTGGAGTGG - Intronic
1097156915 12:57018638-57018660 CTCATTCCTTCCTTCTGGTGTGG - Intronic
1097533342 12:60834032-60834054 CCCAGCCCTGCCATCTGCTGGGG + Intergenic
1097806927 12:63975791-63975813 CTCATTTCTGTCTTCTGGTGTGG - Intronic
1098926171 12:76351182-76351204 CCCATTCTTGCTCTCTGCTCAGG - Intergenic
1099723779 12:86398846-86398868 GACATTCCTTCCCTCTGGTATGG - Intronic
1100738620 12:97566183-97566205 CCCTTTCCTGTACTCTTGTGTGG + Intergenic
1101938793 12:109083506-109083528 TCCATTACTGCCCTCAGCTGAGG + Intronic
1102000321 12:109553669-109553691 CTCATCCCTCCCCTCTGGCGGGG - Intergenic
1102076710 12:110065818-110065840 CCCTGTCCTGCCCCCTGGTCTGG + Intronic
1103342481 12:120228510-120228532 GCCAATGGTGCCCTCTGGTGGGG - Intronic
1103983617 12:124752760-124752782 GCCATGCCTGACTTCTGGTGGGG - Intergenic
1104617311 12:130281468-130281490 CCCCTTTCTTCCCTCTGGAGGGG + Intergenic
1105015449 12:132783970-132783992 CTGATTCCAGCCCTCTGGGGAGG - Intronic
1105686826 13:22792364-22792386 CCCATTTCTGCTCTCTGCAGCGG - Intergenic
1106107023 13:26742028-26742050 CTCATTGCTGGCCTTTGGTGAGG + Intergenic
1106137925 13:26988421-26988443 CCCATGCATACCCTCGGGTGAGG + Intergenic
1106143864 13:27034878-27034900 CCTCTTCCTGCCCACTCGTGAGG - Intergenic
1106222875 13:27761413-27761435 CCCATTTTTGCCCTCTGAGGAGG + Intergenic
1106490386 13:30216284-30216306 TTCCTTCCTGCCCTCTGCTGGGG - Intronic
1107350828 13:39512864-39512886 CCCATTCCTGGCCGTTGGAGAGG + Intronic
1107803303 13:44130896-44130918 CCCCTTCCTGCCGTGTGCTGGGG + Intergenic
1111190723 13:84803329-84803351 CAGATTCCTGCCCAGTGGTGTGG - Intergenic
1111709532 13:91793959-91793981 ACCATATCTCCCCTCTGGTGAGG + Intronic
1112421905 13:99260007-99260029 TCCATTCCAGCCCTCTGGACTGG + Intronic
1113085972 13:106569948-106569970 CCCATCCCTTCCCTCATGTGAGG - Intergenic
1113792240 13:113034998-113035020 CCTTTTCCCGCCCTCCGGTGTGG - Intronic
1114623485 14:24113823-24113845 CCCATCCCTGCCCTCAGGAGCGG + Intronic
1116780157 14:49228097-49228119 CCCATTCCTGCAGTTTGATGAGG - Intergenic
1118443125 14:65829665-65829687 CCCATTCCTGTCCTCCTGGGTGG - Intergenic
1118716535 14:68564031-68564053 CCCATGCAGGCCCTCTAGTGCGG - Intronic
1119205233 14:72789005-72789027 CCCAGTCCAGCCCTCCAGTGAGG + Intronic
1119768469 14:77205619-77205641 TCCATTCCTCCCCTCTGTGGAGG - Intronic
1120214649 14:81668843-81668865 CCCAGCCCTGCCCTGTGGGGAGG + Intergenic
1120788842 14:88561251-88561273 CCCACTCCTGACCCCTAGTGTGG + Intergenic
1121504516 14:94466366-94466388 ACCTTTCCTGCCCTCCCGTGGGG + Intronic
1122757672 14:103995480-103995502 GCTATTCCTGACTTCTGGTGTGG - Intronic
1122812277 14:104295054-104295076 CCCTGCCCTGCCCTGTGGTGGGG + Intergenic
1127988425 15:64093549-64093571 CCCCTCCCAGCCCTCAGGTGAGG + Intronic
1128510965 15:68313737-68313759 CCCATGCCTTCCCTCTCCTGGGG + Intronic
1128567921 15:68713574-68713596 CCCATTCCTTGCCTCTTCTGGGG + Intronic
1128741389 15:70086202-70086224 TCCATTCTAGCTCTCTGGTGGGG - Intronic
1129744238 15:78007182-78007204 CTCCTTCCTGCCCGCTGATGGGG - Intronic
1130707574 15:86247802-86247824 CACATTGCTGCCCTCCGGTCCGG + Exonic
1131382101 15:91972734-91972756 CCCTTGCGTGGCCTCTGGTGTGG + Intronic
1132744939 16:1432653-1432675 CCCCTTCCTGCCCTCAGATCCGG + Intergenic
1132939461 16:2499692-2499714 ACCACTCCTGCCCTGGGGTGGGG + Intronic
1133018612 16:2956070-2956092 CCCCTTCCTGCACCCTGGGGAGG - Intergenic
1133297458 16:4761924-4761946 CCCATTCCAGCCCAGCGGTGTGG + Intronic
1133304071 16:4799104-4799126 CCCATTCCTTCCCTTTGCCGTGG + Intronic
1134125910 16:11615916-11615938 CCCACTCCTCACCTCTGGGGAGG + Intronic
1137783152 16:51114650-51114672 CCCTCCCCAGCCCTCTGGTGAGG + Intergenic
1139487268 16:67264970-67264992 CCCAACCCTGTCATCTGGTGGGG - Intronic
1139607514 16:68030302-68030324 ACCACTCCTGGCCTCCGGTGGGG - Intronic
1140649990 16:77077408-77077430 CCCAGCCCTGCCCTGTGGGGAGG - Intergenic
1142201308 16:88762350-88762372 CCCATCACTGACCTCAGGTGGGG - Intronic
1142308096 16:89296864-89296886 CCCATTCCTGCCCTCTGGTGGGG - Intronic
1142714972 17:1742359-1742381 CCCTTTCCTCCCCTCAGGAGCGG + Intergenic
1142983196 17:3683172-3683194 CCCAACCCTGCCCTGTGCTGTGG - Intronic
1143183298 17:4997243-4997265 CCCAGTCGTGCCCTCGGGCGGGG - Intronic
1144584599 17:16480699-16480721 CCCATTCTTCCCCTCTCCTGAGG + Intronic
1144888187 17:18477921-18477943 CCCAACCCTGGCCTCTGCTGAGG - Intronic
1144999679 17:19295274-19295296 CGAACTCCTGCCCTCAGGTGAGG - Intronic
1148519238 17:48253823-48253845 ACCTTTCCTGCCTTCTGATGAGG - Intronic
1151255209 17:72871494-72871516 CCCAAACCTGGCCTCTGGGGAGG + Intronic
1151713167 17:75818185-75818207 CCCCTTCCTCCCCTCTGCTGTGG + Intronic
1154133078 18:11752416-11752438 CCCATGCCTGCCCGCTGGGATGG - Intronic
1154167060 18:12023590-12023612 CTCATCTCTGCCCTCAGGTGTGG + Intronic
1154339882 18:13493989-13494011 CGCAATCCTGCCTTATGGTGTGG + Intronic
1156487852 18:37477934-37477956 CCCACCCCTGCCCTCTGCTCAGG - Intronic
1157281000 18:46346225-46346247 CCCCTTCCCACCCACTGGTGGGG - Intronic
1157537901 18:48474071-48474093 CCCATCCCAGCCCACTGGAGTGG - Intergenic
1161357357 19:3826373-3826395 CCCCTCCCTGCTCTCAGGTGGGG + Intronic
1162432028 19:10634902-10634924 CCCATTCCTGCCCCCACATGAGG + Intronic
1165781062 19:38434600-38434622 CCCATCCCTGCCCCCAGCTGGGG - Intronic
1165830297 19:38727323-38727345 CCAAGTCCTGCCTTCTGGGGTGG + Intronic
1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG + Exonic
1168151526 19:54451436-54451458 CCCAGTGCTGTCCTCTGGGGTGG + Intronic
925271005 2:2607399-2607421 ACCATTGCTGCCCTCAGCTGAGG + Intergenic
925844209 2:8020756-8020778 GCCATGCCTGCCCTGTGATGAGG + Intergenic
926084107 2:10010268-10010290 CCCATGCCTGCTCTCCAGTGTGG - Intergenic
927491031 2:23521130-23521152 CCCCTGCCTGCCATGTGGTGTGG + Intronic
927739187 2:25552247-25552269 CCCATTCCTGCCCTCCAGGCAGG - Intronic
928321037 2:30283059-30283081 CCCATTCCTCCCCACTGGCCAGG + Intronic
929109879 2:38397491-38397513 CCCAGCCCTGCCCTGTGGGGAGG - Intergenic
929610842 2:43269624-43269646 CCCATTCCTGCCAGCTGCAGTGG - Intronic
934041361 2:88129893-88129915 CCCCTTCCTGCCCGCTGTTCAGG - Intergenic
934062482 2:88308014-88308036 TCTAATGCTGCCCTCTGGTGGGG + Intergenic
934857989 2:97740808-97740830 CCCATTCCTGTCCCCTGTTGGGG + Intergenic
936069095 2:109353505-109353527 CCCCTTGCTGCCCTATGTTGGGG - Intronic
937348378 2:121142655-121142677 CCAATTCCAGGGCTCTGGTGGGG - Intergenic
938251630 2:129820181-129820203 CCCACTTCTGCCCACTGGGGAGG + Intergenic
943042768 2:182822973-182822995 CTCATTCCTGCACACTGGAGCGG + Intergenic
947298060 2:228655351-228655373 CAAATTCCTTCCCACTGGTGGGG - Intergenic
948570766 2:238915793-238915815 CCCACTCCTGCCAGCTGGAGGGG + Intergenic
948882125 2:240864522-240864544 CCCCTTCCAGCCCTCTGGACTGG + Intergenic
949013899 2:241698680-241698702 CACAGTCCTGCCCCCTGGGGAGG + Intergenic
1169692481 20:8347430-8347452 CCCTTTTCTGCCTTCTGGTTTGG - Intronic
1170697948 20:18676889-18676911 CCCTTTCCTGCCCTTTTGGGGGG - Intronic
1171790241 20:29516140-29516162 CCCTTTCCTGCCCCCTCATGTGG - Intergenic
1172519666 20:35558598-35558620 CCCTTTTCTTCCCTGTGGTGGGG + Intergenic
1172902603 20:38346097-38346119 CTCAACCCTGCCCTCTGCTGGGG + Intergenic
1174407535 20:50311900-50311922 CACATTCCTGCGCTTTCGTGAGG - Intergenic
1174586583 20:51613396-51613418 GTCATTCCTGCCATGTGGTGAGG - Intronic
1175315303 20:58043212-58043234 CCTATTTCTGCCCTGGGGTGTGG - Intergenic
1176107980 20:63398586-63398608 TCCTTGCCTGCCCTCTGCTGAGG - Intergenic
1178674633 21:34620786-34620808 CCCATCCCTGCCCTATGGACAGG + Intergenic
1180138788 21:45878268-45878290 CCCATCCCTGCCCTCCGGGGTGG + Intronic
1180578576 22:16806035-16806057 CCAACTCCTGACCTCTAGTGAGG - Intronic
1181162205 22:20965616-20965638 CCCAGTCCTGCCTTCGAGTGTGG - Intronic
1182190096 22:28450927-28450949 CCCTTTCCTGCCCTGTAGTCTGG - Intronic
1182475262 22:30573681-30573703 CCCTTTCCTTCCCCCTGGTGTGG + Intronic
1183322392 22:37172995-37173017 ACCATCCCTTCCTTCTGGTGTGG + Intronic
1183621317 22:38974501-38974523 CCCAGTTCTGCCCTCTGGACGGG + Intronic
1183738515 22:39657157-39657179 CCCAGTCGTGGCCTCTAGTGTGG + Intronic
1184519384 22:44983557-44983579 CCCTCGCCTGCCCTTTGGTGTGG - Intronic
1184616948 22:45644928-45644950 ACCACTCCTGGCGTCTGGTGGGG - Intergenic
1185026170 22:48414556-48414578 CCCAGTCCTGCCCTCATGTGAGG + Intergenic
950187800 3:10956145-10956167 GCCATTCCTGCACTTTGTTGAGG + Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951923507 3:27881182-27881204 TCCCTTACTGCACTCTGGTGAGG + Intergenic
953934528 3:47028884-47028906 CCTACTCCTGCCCTGTGGTCAGG - Intronic
954323490 3:49848079-49848101 CACATTCCTGCTCTCTGCTAAGG + Intronic
954688289 3:52382465-52382487 CCGAGCCCTGCCCTCTGCTGTGG - Intronic
955820214 3:62888707-62888729 CCCACTCTTACCCTCTGCTGAGG + Intergenic
956072327 3:65466663-65466685 CCTCTTCCTCCCCACTGGTGTGG - Intronic
957240541 3:77655656-77655678 CCCATTCCAGCCCTGGGGTCTGG - Intergenic
959621283 3:108400905-108400927 CCCCATTCTGCCCACTGGTGAGG + Intronic
962752160 3:138441404-138441426 CACCTTCCTGCCCACTGGAGAGG - Intronic
966365050 3:179176373-179176395 AACATTCCTCACCTCTGGTGAGG + Intronic
966971266 3:185047723-185047745 CCCCTTCCTTCCCACAGGTGAGG + Intronic
967182296 3:186916553-186916575 GGCATTTCAGCCCTCTGGTGTGG - Intergenic
968314453 3:197711111-197711133 ACCACGCCTGGCCTCTGGTGAGG + Intronic
968702412 4:2063215-2063237 CCCTTTGCGGCCCTCTGCTGTGG + Intronic
970793528 4:19887960-19887982 CCCATGCCTACCCTCTGTTATGG + Intergenic
973308621 4:48682007-48682029 CCTTTGCCTGCCCTCTTGTGGGG + Intronic
978161601 4:105555074-105555096 CCCATGTCTGCTCTCTTGTGTGG - Intronic
981843416 4:149138207-149138229 CCCATCCCTGCCCTGTGGCCAGG - Intergenic
983303115 4:165952864-165952886 CCCATTCTTGCTCTTTAGTGGGG - Intronic
983836325 4:172391188-172391210 CACAGTTCTGCTCTCTGGTGAGG + Intronic
985361457 4:189179823-189179845 ATCATCCCTCCCCTCTGGTGTGG + Intergenic
985518868 5:361337-361359 CCCACTCCTGGCCTCTGCTGAGG - Intronic
985649885 5:1102562-1102584 CCCCTTCCTGCCCTCCAGCGTGG + Intronic
986083982 5:4424454-4424476 CCCATGGCTGCCCTCGGCTGGGG + Intergenic
986216204 5:5721470-5721492 GCCATTCCTGAGGTCTGGTGGGG - Intergenic
986389604 5:7272373-7272395 CCCTTTGCTGCCCTCTGTTACGG + Intergenic
987199004 5:15555684-15555706 CCCATTGCAGTCCTCTGGTTAGG + Intronic
988893015 5:35639741-35639763 TCCCTTCTTGCCATCTGGTGAGG - Intronic
989777401 5:45225841-45225863 CCCAGCCCTGCCCTGTGGGGAGG - Intergenic
991622743 5:68562392-68562414 CCCTTTCCTGCCCTGAGGTTAGG - Intergenic
995583960 5:113627952-113627974 CCCATTTGTTTCCTCTGGTGTGG + Intergenic
997648126 5:135494646-135494668 TCCCTTCCTGCCTTCTGGAGAGG + Intergenic
997846540 5:137291533-137291555 CCCATACCTGACCTCAGTTGTGG - Intronic
1000244479 5:159438002-159438024 AGGATGCCTGCCCTCTGGTGAGG - Intergenic
1001491988 5:172162524-172162546 TTCTTTCCAGCCCTCTGGTGGGG - Intronic
1001804726 5:174573617-174573639 CCCAGTTCCGCCCTCTGGAGTGG - Intergenic
1004762301 6:18681036-18681058 CACAGACATGCCCTCTGGTGGGG + Intergenic
1006216017 6:32443384-32443406 CCCCTTCCTGCCCTCAACTGAGG + Exonic
1006583410 6:35089607-35089629 CCCATCCCTGGCCCCCGGTGTGG + Exonic
1007410461 6:41658373-41658395 CCCAGCCCTGCCCCCTGCTGTGG - Intergenic
1007775429 6:44222219-44222241 CATCTTCCTGCCCTCTGGTTAGG + Intronic
1007779904 6:44246745-44246767 CCCAGTCCCGCCCTTGGGTGTGG + Intronic
1012005043 6:93703216-93703238 CCCATTCCTTCCCACCTGTGTGG + Intergenic
1012378060 6:98586332-98586354 CCCACTTTTGCCCTCTGCTGGGG + Intergenic
1012438215 6:99237465-99237487 CACATTCCTGCCTTCTGGAAGGG + Intergenic
1014832804 6:126122566-126122588 TGCATTCCTTCCTTCTGGTGTGG - Intergenic
1016736569 6:147485970-147485992 CCCATTCCTTTCCCCTTGTGTGG - Intergenic
1017344667 6:153367222-153367244 TCCGTTCCTGCCCTGTGGTCTGG + Intergenic
1019304771 7:328040-328062 CCCGTTCATTCCCTCTTGTGGGG + Intergenic
1024803118 7:53103863-53103885 ACCATTCCTGCCTTCTTTTGTGG - Intergenic
1026828757 7:73599370-73599392 CCCATCTCTGCCCTCTGGGAGGG - Intronic
1027950829 7:84812847-84812869 CCCAACCCTGCCCTCTGATCAGG + Intergenic
1027962270 7:84961101-84961123 CCCATTCGTACCCTTTGGTAAGG + Intergenic
1029489017 7:100860267-100860289 CCCCATCCTGCCAGCTGGTGGGG - Intronic
1030007708 7:105134914-105134936 CTCATACCTGGCCTTTGGTGAGG - Intronic
1032636810 7:133718255-133718277 CTCATTCTTGCCCTGTGGTAAGG - Intronic
1034495254 7:151417037-151417059 CCCGTTCCTGCTCTGTGGTCTGG - Intergenic
1034749367 7:153554467-153554489 ACCGTTCCTGGCCTCTGGTTGGG - Intergenic
1035304647 7:157924029-157924051 CCCATCCCTGCCGTCTGCTATGG - Intronic
1035630730 8:1104838-1104860 CCACTTCCTGCTCTCTGGTGAGG - Intergenic
1036176689 8:6545552-6545574 ACCATTCCAGCCATCTGATGAGG + Intronic
1038709893 8:29933775-29933797 CCCATTCCTGCCTTCTGGGTGGG + Intergenic
1038950595 8:32410140-32410162 CCCATTCCTGCCCTAAGGAAAGG + Intronic
1046996477 8:120529687-120529709 CACATGCCTGCCAGCTGGTGTGG - Intronic
1047344751 8:124016203-124016225 CCCATTCCTGCCTTTTCTTGTGG - Intronic
1049261624 8:141642068-141642090 CCCCTTCTTGCCCTGCGGTGAGG - Intergenic
1049568338 8:143355160-143355182 CCGGTACCTGCCCTCTGGTGAGG - Intronic
1050010266 9:1178968-1178990 AAGATTCCTTCCCTCTGGTGAGG + Intergenic
1051666575 9:19472033-19472055 CCCAGACCTGCCAACTGGTGTGG - Intergenic
1052014582 9:23450097-23450119 CCGAGTCCTGCCCCTTGGTGTGG + Intergenic
1052350047 9:27448990-27449012 CCCATTCCTACCCTCTGCTGAGG + Intronic
1053069625 9:35093409-35093431 CCCAGGCCTCACCTCTGGTGGGG + Exonic
1053410496 9:37913435-37913457 CCCATTCATGCCCACTGGGAAGG - Intronic
1056074792 9:83027321-83027343 CCCATCCCTGACCTCTGGGGAGG - Intronic
1056491566 9:87112919-87112941 CCCATGACTGCTCTGTGGTGGGG - Intergenic
1057221670 9:93260857-93260879 CCCCCTCCTGCTCCCTGGTGTGG - Intronic
1057602829 9:96473387-96473409 CCCAGTCCTTCCCTCTGCTCTGG + Intronic
1060754762 9:126204430-126204452 CCCCTTCCTGCCCGCTGGCCAGG - Intergenic
1061200034 9:129132702-129132724 CGAACTCCTGACCTCTGGTGAGG + Intronic
1061580791 9:131534611-131534633 CTCTTACCTGCTCTCTGGTGCGG + Intergenic
1062451301 9:136616863-136616885 CACACTCATCCCCTCTGGTGGGG - Intergenic
1062581231 9:137230132-137230154 CCTCTTCCTGCCCTGGGGTGCGG - Intergenic
1187434458 X:19254338-19254360 CTCATTCCTGCTCTCAGCTGGGG - Intergenic
1188816256 X:34718436-34718458 CCCATTTCAACCCTTTGGTGAGG + Intergenic
1190222364 X:48520656-48520678 CCCCTTCCTGCCTTGTGGTGGGG - Exonic
1190868295 X:54403220-54403242 CGAATTCCTGACCTCAGGTGAGG + Intergenic
1191805244 X:65129123-65129145 CCCTTTCTTGCCTTCTTGTGTGG + Intergenic
1192237419 X:69304741-69304763 CCCATTCCTGTCCGCAGGCGGGG + Intergenic
1192801091 X:74465613-74465635 CTCTTTCCTGCCTTCTAGTGGGG - Intronic
1196190555 X:112790108-112790130 CCCATCCCTGCCCTTTGGGAAGG - Intronic
1196340230 X:114586296-114586318 CCCATTCCACCCCACAGGTGGGG + Intronic
1196893328 X:120310619-120310641 CCCAGCCCTGCCCTCTGCAGCGG - Intronic
1197623921 X:128781690-128781712 GCCATTGCTGCCACCTGGTGGGG + Intergenic
1200272512 X:154699177-154699199 CACTTTCCGGCCCTCTGGGGTGG + Intronic
1201393317 Y:13522087-13522109 CCCCTTCCTGCACACTGGAGTGG + Intergenic