ID: 1142309973

View in Genome Browser
Species Human (GRCh38)
Location 16:89306681-89306703
Sequence GTGGCACGTGTCTGCGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 2, 1: 31, 2: 9, 3: 11, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142309973 Original CRISPR GTGGCACGTGTCTGCGGAGT GGG (reversed) Intronic
900428441 1:2591041-2591063 GTGGAACGTGTCTGCGAAGGCGG + Exonic
911494690 1:98616665-98616687 GTGGCAGGAGTCAGGGGAGTGGG - Intergenic
915065032 1:153217910-153217932 GTGGCACCTGTCTCCAAAGTGGG - Intronic
915702223 1:157806885-157806907 CTGACACGTGTCTGCTCAGTGGG - Intronic
1063587388 10:7364837-7364859 GTGGCACCTGCGTGCAGAGTTGG + Intronic
1066686186 10:37983722-37983744 GTGGCCCGTGTCTCCTGAGTTGG + Intergenic
1069334103 10:67328121-67328143 CTGGCATGTGTCTGTGGAGGTGG - Intronic
1071507925 10:86243902-86243924 GTGGCACGTGTGTGCAGAGATGG - Intronic
1078346536 11:10554615-10554637 GTGACTGGTGTCTGTGGAGTGGG + Intergenic
1082787421 11:57324635-57324657 GTGGCGCGTGTGCGCGGAGGCGG - Intronic
1083958256 11:65998937-65998959 GTGGCACACGTTTGGGGAGTGGG - Intronic
1084318363 11:68358921-68358943 GTGGCAGGTGTCTGTGCAGAGGG + Intronic
1084741715 11:71144311-71144333 GTTGCACCTGACTGCAGAGTAGG - Intronic
1089317289 11:117600735-117600757 GTGCCACGTGGCTGTGGAGATGG + Intronic
1090198911 11:124839931-124839953 TTGGCACGTGTCTGCGGCGCTGG - Intergenic
1094628657 12:32150654-32150676 GTGGCACAAGTTTGGGGAGTAGG + Intronic
1097979152 12:65719220-65719242 GTGGCAGGTATGTGAGGAGTGGG - Intergenic
1102701685 12:114844821-114844843 GTGGCATGTGTCTGTGGTGCTGG + Intergenic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1103736664 12:123065055-123065077 GTGGCAAGTGCCTGCAGAATGGG - Intronic
1103742453 12:123100005-123100027 GGAGTAGGTGTCTGCGGAGTAGG - Intronic
1104346659 12:128005691-128005713 GTGCCACATGTCTGCAGAGCAGG + Intergenic
1104847345 12:131853094-131853116 GTGGGCCTTGTCTGCTGAGTCGG + Intergenic
1108496178 13:51027540-51027562 TTGCCAAGTGTCTGCGTAGTGGG - Intergenic
1113522058 13:110948085-110948107 GACACACGTGTCTGCTGAGTGGG + Intergenic
1113639539 13:111947310-111947332 GATGCAGGTGTCTGTGGAGTTGG - Intergenic
1118363211 14:65072912-65072934 GGGGCACATCTCTGAGGAGTGGG + Intronic
1122117388 14:99534736-99534758 GTCTCACCTGTCTGTGGAGTGGG - Intronic
1122597272 14:102902356-102902378 GTGGGAGGGGTCTGAGGAGTGGG + Intronic
1125882964 15:43209399-43209421 GTGGCCTGGGTCTGCGGGGTGGG + Exonic
1128239171 15:66089281-66089303 GTGCCCAGTGTCTGGGGAGTAGG + Intronic
1132525232 16:410982-411004 GCGGCACTTGGCTGTGGAGTGGG + Exonic
1132788500 16:1671540-1671562 GTGGCAGGTGTGTGGGCAGTCGG + Intronic
1142309761 16:89305670-89305692 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309766 16:89305695-89305717 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309771 16:89305720-89305742 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309777 16:89305749-89305771 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309782 16:89305774-89305796 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309787 16:89305799-89305821 GTGGCGCATGTCTGCGGAGTGGG - Intronic
1142309792 16:89305828-89305850 GTGGTGCGTGTCTGCGGAGTGGG - Intronic
1142309797 16:89305853-89305875 GTGGTGCGTGTCTGCGGAGTGGG - Intronic
1142309804 16:89305882-89305904 GTGGCACGTGTCTGCGGAGTGGG - Intronic
1142309811 16:89305911-89305933 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309818 16:89305940-89305962 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309825 16:89305969-89305991 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309832 16:89305998-89306020 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309839 16:89306027-89306049 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309846 16:89306056-89306078 ATGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309851 16:89306085-89306107 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309861 16:89306137-89306159 GTGGTGCGTGTCTGCGGAGTGGG - Intronic
1142309866 16:89306162-89306184 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309872 16:89306191-89306213 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309878 16:89306220-89306242 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309883 16:89306245-89306267 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309888 16:89306274-89306296 GTGGCGTGTGTCTGCGGAGGGGG - Intronic
1142309896 16:89306303-89306325 GTGGCACGTGTCTGCGGAGGGGG - Intronic
1142309903 16:89306328-89306350 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309909 16:89306357-89306379 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309914 16:89306386-89306408 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309920 16:89306415-89306437 GTGGCGCGTGTCTGCAGAGTGGG - Intronic
1142309924 16:89306440-89306462 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309931 16:89306469-89306491 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309936 16:89306494-89306516 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309943 16:89306523-89306545 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309948 16:89306552-89306574 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309953 16:89306577-89306599 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309958 16:89306602-89306624 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309964 16:89306631-89306653 GTGGTGCGTGTCTGCGGAGTGGG - Intronic
1142309969 16:89306656-89306678 GTGGCACGTGTCTGCACAGTGGG - Intronic
1142309973 16:89306681-89306703 GTGGCACGTGTCTGCGGAGTGGG - Intronic
1142309978 16:89306706-89306728 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309985 16:89306735-89306757 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309990 16:89306764-89306786 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142309996 16:89306793-89306815 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142310001 16:89306818-89306840 GTGGCGCGTGTCTGTGGAATGGG - Intronic
1142310006 16:89306847-89306869 GTGGCGCGTGTCTGCGGAGTGGG - Intronic
1142310011 16:89306872-89306894 GTGGCGCGTGTCTGTGGAGTGGG - Intronic
1142310017 16:89306901-89306923 AGCGCACGTGTCTGCGGAGTGGG - Intronic
1147174347 17:38643919-38643941 GTGGCACGTGCCTGCTCAGGAGG + Intergenic
1152487533 17:80603968-80603990 GTGGCTGGGGTCTGCGGACTTGG - Intronic
1152689538 17:81711914-81711936 GGGCCACGTGTGTGCGGCGTGGG - Intergenic
1152917792 17:83051128-83051150 GGGGCACGTGTGTGGGGTGTGGG + Intronic
1160403803 18:78630466-78630488 TAGGCAGGTGTCTGCGGGGTCGG + Intergenic
1161007871 19:1945328-1945350 GGGGCACGCGTCTGAGGTGTGGG + Intronic
1167370654 19:49079403-49079425 GTGGCACGCGTCTGTGGAGGTGG - Intergenic
924986331 2:273427-273449 GTGGCAGGAGTCTGCAGATTGGG + Intronic
939366679 2:141242210-141242232 TTGGCAGGTGTCTGTGTAGTGGG - Intronic
942740774 2:179175042-179175064 GTGGCATGTGTCTGCTGAGGTGG - Intronic
945326591 2:208489247-208489269 GATGCACCTGTCTGGGGAGTTGG + Intronic
945471251 2:210229876-210229898 GTGGAACTTGTCTGTGGAGACGG + Intergenic
946430937 2:219627285-219627307 GGGGCCTGTGTCTGCGGAGGGGG + Intergenic
946905834 2:224415151-224415173 GTGGCACGTGCCTGTAGTGTTGG - Intergenic
947534188 2:230930582-230930604 GTGGCACGTGTCTGCAGTCCTGG - Intronic
948663341 2:239520017-239520039 GGGGCACGTGTCTGGGGTGCTGG + Intergenic
1169355421 20:4901183-4901205 CTGGCAGGTGTCTGTTGAGTAGG - Intronic
1171123827 20:22585382-22585404 GCGGCCGGTGTCTGAGGAGTCGG - Intronic
1171331827 20:24346832-24346854 GAGGCTCGTGTCTGCTGTGTTGG - Intergenic
1172107358 20:32524737-32524759 GGGCCTCGTGTCTGCAGAGTGGG + Intronic
1172892767 20:38278558-38278580 GAGTCTCGGGTCTGCGGAGTGGG + Intronic
1173193910 20:40897869-40897891 GTGGCTGGTGCCTGCTGAGTTGG - Intergenic
1173470173 20:43317500-43317522 GTGGCTGGTGGCTGCTGAGTTGG - Intergenic
1180658844 22:17447915-17447937 GTGGCTCGTGGCTGCTGTGTTGG + Intronic
1180791405 22:18577478-18577500 GCGGCGCGGGTCTGCGGAGCGGG - Intergenic
1181230334 22:21417833-21417855 GCGGCGCGGGTCTGCGGAGCGGG + Intronic
1181248316 22:21517030-21517052 GCGGCGCGGGTCTGCGGAGCGGG - Intergenic
1184499220 22:44861790-44861812 GTTGCACGTGTTGGCGGAGATGG + Intronic
1184732602 22:46378904-46378926 GTGGCTCTTGTCTTCGGTGTAGG - Intronic
955132923 3:56188503-56188525 GTGGCACGTGTCTGCAGCCAGGG - Intronic
962318656 3:134374059-134374081 GTGGCTGTTGTCTCCGGAGTCGG + Intronic
963295093 3:143537456-143537478 GTGGCAGGTGGCAGCAGAGTGGG - Intronic
964859037 3:161180137-161180159 GAGGTACTTGTCTGCTGAGTTGG + Intronic
972050065 4:34720108-34720130 GTGGCAGGTGTCTGTGGTCTTGG + Intergenic
981809806 4:148760958-148760980 GTGGCACGTGTTTCCAGAATAGG + Intergenic
996434857 5:123423122-123423144 GTGGGACCTGGCTGCGGAGCGGG - Exonic
998428497 5:142050080-142050102 GTGGCTAGTGTCTGCAGATTTGG + Intergenic
1001704035 5:173729035-173729057 GTGGCAGGTGGATGGGGAGTGGG - Intergenic
1001759049 5:174192554-174192576 GTGGCACTTGGCTGGGGAGTGGG - Intronic
1032489791 7:132315843-132315865 GTGCCACGTGTGTGCAGTGTAGG + Intronic
1040825061 8:51611844-51611866 GTGGGAACTGTCTGCGGAGTAGG + Intronic
1056399539 9:86213134-86213156 GTAGCCAGTGTCTGCAGAGTTGG + Intergenic
1056455989 9:86760687-86760709 GTGGCACTTGTCTGTGGTCTCGG + Intergenic
1057815440 9:98290616-98290638 GTGGCACATGTCTGTGGCGGGGG + Exonic
1062696260 9:137877761-137877783 GTGGCGCGGGGCCGCGGAGTCGG + Intergenic
1200853554 Y:7911434-7911456 GTGGCACATGTCTGCAAAGGTGG + Intergenic
1202115960 Y:21468988-21469010 GTTGCTTGTGTCTGAGGAGTGGG - Intergenic
1202266124 Y:23021112-23021134 GTGGCACATGTCTGCAAAGGTGG - Intergenic
1202419117 Y:24654855-24654877 GTGGCACATGTCTGCAAAGGTGG - Intergenic
1202451669 Y:25015229-25015251 GTGGCACATGTCTGCAAAGGTGG + Intergenic