ID: 1142310282

View in Genome Browser
Species Human (GRCh38)
Location 16:89308361-89308383
Sequence GGAAAGCCCCACACTGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142310280_1142310282 -1 Left 1142310280 16:89308339-89308361 CCACACTGTTTGTGATGTGGGAG 0: 1
1: 0
2: 2
3: 14
4: 141
Right 1142310282 16:89308361-89308383 GGAAAGCCCCACACTGATCAAGG 0: 1
1: 0
2: 0
3: 9
4: 125
1142310277_1142310282 13 Left 1142310277 16:89308325-89308347 CCTGGGATAAAATTCCACACTGT 0: 1
1: 0
2: 0
3: 7
4: 196
Right 1142310282 16:89308361-89308383 GGAAAGCCCCACACTGATCAAGG 0: 1
1: 0
2: 0
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142310282 Original CRISPR GGAAAGCCCCACACTGATCA AGG Intronic
900203794 1:1422525-1422547 GGAAAGTCCCGTACTCATCAGGG + Intergenic
901988808 1:13095915-13095937 GGACAGCCCCTGAATGATCAGGG - Intergenic
901993005 1:13130852-13130874 GGACAGCCCCTGAATGATCAGGG + Intergenic
903670162 1:25030845-25030867 GGAGAGGCCCACACTGAGGAAGG - Intergenic
904613730 1:31738844-31738866 GGAGAGCTCCACAGTGATGAGGG + Exonic
905934167 1:41810558-41810580 GGCTGGCCCCACACTGATCCTGG + Intronic
906746670 1:48226634-48226656 CCCAAGCCCCACACTGTTCATGG - Intronic
906802416 1:48749654-48749676 GAAAAGCCCCACAATCATGAGGG + Intronic
907403609 1:54240613-54240635 GGAAATGCCCACCCTGAACAGGG + Intronic
910839080 1:91544763-91544785 GGAAAGACACACAATGTTCATGG - Intergenic
920863891 1:209735383-209735405 GCAAAGCCCTATATTGATCAGGG + Intergenic
923861951 1:237900208-237900230 GGAAGGCACCAAAATGATCAAGG - Intergenic
1064791581 10:18962516-18962538 GGAAAGCCTCACAATCATCGTGG + Intergenic
1064977445 10:21133412-21133434 GGACTGCCCCACACTGATTGGGG - Intronic
1066568687 10:36748427-36748449 GCTAAGCCCCTCACTGCTCAGGG - Intergenic
1066613611 10:37275570-37275592 GGTAAGCCCCTCACTGCCCAGGG + Intronic
1067328147 10:45289323-45289345 TTAAAGCCCCACAATTATCATGG - Intergenic
1069447675 10:68488583-68488605 GGAAAGCCCAACACTCTTCAAGG + Exonic
1076075684 10:127532067-127532089 GGAAAACCCCACCCTGTACAGGG + Intergenic
1076178203 10:128384996-128385018 GCAAAGCCGCACACTGAGCGCGG - Intergenic
1076564635 10:131389749-131389771 AGGATTCCCCACACTGATCAGGG - Intergenic
1090806163 11:130203614-130203636 GGAAACCCTCACACTGAGCATGG - Intronic
1091107520 11:132936646-132936668 GGAAAGCCATACACAGATCTAGG + Intronic
1092149407 12:6236770-6236792 GGACAGCCCCAGACGGAACATGG + Intronic
1092918858 12:13212840-13212862 GGATTCCCCCAGACTGATCATGG - Intronic
1096496619 12:52042696-52042718 GAGAAGGCCCACACTGATCTGGG + Intronic
1098640848 12:72836905-72836927 GGAACACCCCACTGTGATCAAGG - Intergenic
1100164528 12:91901317-91901339 TGAAAGTCCCAAACTGAGCAGGG - Intergenic
1105406098 13:20133884-20133906 GGAAGGCCCCACACTCAGCTGGG - Intergenic
1107510983 13:41084706-41084728 GGAAAACCCCATAGTGGTCATGG - Intergenic
1113401085 13:109993997-109994019 GGAAAGCCCCTGACAGAGCACGG - Intergenic
1120688680 14:87568018-87568040 GGAAAGCCTCACACTGCCAATGG - Intergenic
1121030352 14:90653459-90653481 GGCAAACCTAACACTGATCATGG + Intronic
1124227219 15:27904583-27904605 GCTCAGCCCCTCACTGATCATGG + Intronic
1126904483 15:53349639-53349661 GAAAAGGCCCACAATGATGAGGG + Intergenic
1127331297 15:57942791-57942813 GCAATGCCCAACACTGAGCATGG + Intergenic
1131535247 15:93232067-93232089 GGTCAGCCCCACAGTGAGCAGGG - Intergenic
1132830119 16:1923842-1923864 GAAAAACCCCACACAAATCAAGG - Intergenic
1133248729 16:4466223-4466245 GGGCAGCCGCACACTGGTCATGG + Exonic
1141722318 16:85763287-85763309 GGGAAGCCCCACGCTGACCCGGG - Intergenic
1142310282 16:89308361-89308383 GGAAAGCCCCACACTGATCAAGG + Intronic
1142560507 17:806418-806440 AGAAAGCCCCACTCTGGTCAAGG + Intronic
1144042839 17:11428388-11428410 GAAAAGGCCCACTCTGAGCATGG + Intronic
1147246335 17:39123604-39123626 GGAAAGGCCCAAACAAATCAGGG - Intronic
1147634514 17:41955307-41955329 GGAAAGGCTCACACTGATGATGG - Exonic
1150711184 17:67532110-67532132 GGAAGGCTCCACACTCTTCATGG + Intronic
1151220212 17:72606294-72606316 GAAGAGCCCCCCACTGACCATGG + Intergenic
1151220233 17:72606363-72606385 GAAGAGCCCCCCACTGACCATGG + Intergenic
1151220255 17:72606432-72606454 GAAGAGCCCCCCACTGACCATGG + Intergenic
1152325391 17:79633113-79633135 GCAACGCCCCACAGTGTTCACGG + Intergenic
1152517464 17:80834167-80834189 GGACAGCCCCACTCAGAGCAAGG - Intronic
1152549268 17:81021249-81021271 GGAAAGCCCCTCAGTGCTCCGGG + Intergenic
1155756230 18:29500050-29500072 TGAAACCCCCACATTGTTCAAGG - Intergenic
1159440305 18:68470442-68470464 AGAAAGTCCCACACTCATCGTGG - Intergenic
1161766008 19:6209301-6209323 GGAAAGCCACACTCTGATGCTGG + Intergenic
1163350765 19:16775441-16775463 GGACAGCCCTACACTGAAAATGG - Intronic
1165846576 19:38821611-38821633 GCTAAGCCCCTCACTGCTCAGGG - Intronic
1166854557 19:45777103-45777125 GTAAGGCCCCAGAGTGATCAGGG - Intronic
1168461404 19:56561973-56561995 GGAAAGCTCCCCAGTCATCAAGG + Intergenic
925894759 2:8462853-8462875 GGAAAGCCCCACAGGCCTCACGG + Intergenic
926344335 2:11931427-11931449 GGAAAGCCCCAGATAGTTCAGGG - Intergenic
928425632 2:31175475-31175497 GGACAGCCCAAAACTGAGCAGGG - Intronic
931066572 2:58594503-58594525 GGAGAGCCCCCCACTGCGCAGGG + Intergenic
931604052 2:64033967-64033989 GGAAAGCCCAAGTCTGTTCAGGG - Intergenic
934491494 2:94764316-94764338 GAGCAGGCCCACACTGATCAGGG + Intergenic
934751361 2:96796060-96796082 GGAAAGACCCAAACTGACAAGGG - Intronic
938312934 2:130305882-130305904 GGACAGCCCCAAAAAGATCAGGG + Intergenic
942996456 2:182266821-182266843 AGAAAGCCACACACTAAGCATGG + Intronic
945498189 2:210535243-210535265 GGAAAACCCCTCACTCAGCATGG - Intronic
947598176 2:231427082-231427104 GCAAAGGCCCACACCAATCATGG - Intergenic
947743790 2:232497331-232497353 GGAAAGCCCCCAAATGATGAGGG - Intergenic
949074299 2:242045325-242045347 GGACACCCCCACTCTGTTCACGG - Intergenic
1168875662 20:1170636-1170658 GGAAGGCCACACACTGAGAAAGG - Intronic
1175741388 20:61421947-61421969 TGTCAGCCCCACACTGCTCAAGG - Intronic
1177194708 21:17891470-17891492 TGAAAGCCACACACTGTTCATGG - Intergenic
1181725813 22:24810222-24810244 GGAAACCCACACACTGATAAAGG - Intronic
1182773325 22:32811806-32811828 GGCAAGCCCAACACTTGTCAAGG + Intronic
1185002576 22:48254981-48255003 GGAAAGCCACTCTCTGAGCAAGG + Intergenic
951455927 3:22892176-22892198 TGAAAGCTCCACAGAGATCAGGG + Intergenic
953954752 3:47222922-47222944 ACAAAGCCCTACAGTGATCATGG + Intergenic
956376510 3:68618974-68618996 GGAAAGCACAAGATTGATCATGG - Intergenic
959462448 3:106643885-106643907 GGTAAGCCCCTCACTGCCCAGGG - Intergenic
961932325 3:130547305-130547327 GCTAAGCCCCTCACTGCTCAGGG + Intergenic
969521727 4:7681929-7681951 GGAATGCCCACCACTTATCAAGG - Intronic
969633370 4:8351306-8351328 AGAAAGCCCCACACTGAGGAGGG + Intergenic
970702232 4:18755812-18755834 GGAAAACCCTAAAATGATCATGG - Intergenic
985584602 5:723737-723759 GGAGAGCCCCATTCTGACCACGG - Intronic
985598109 5:808067-808089 GGAGAGCCCCATTCTGACCACGG - Intronic
987163745 5:15172523-15172545 GGAAAGACACACAGTGATAATGG + Intergenic
987680653 5:21132563-21132585 GGGAAGCCTCACAATCATCATGG - Intergenic
987783048 5:22464209-22464231 GGGAAGCCTCACAATCATCAGGG - Intronic
991599010 5:68334236-68334258 GGTCAGCCCCCCACTGACCAGGG + Intergenic
995700355 5:114928952-114928974 GCTAAGCCCCTCACTGCTCAGGG - Intergenic
999175148 5:149626935-149626957 TGAAGGGCCCACCCTGATCAGGG - Intronic
1001299257 5:170522216-170522238 GGGAAGCCCTGCCCTGATCATGG + Intronic
1003872860 6:10415560-10415582 GCAAAGCCCGGCACTGCTCAAGG + Intronic
1004014422 6:11719117-11719139 GGAGAGCACCACACTGCACAAGG + Intronic
1004338934 6:14790015-14790037 GGAAAGGCCCAGAGTGCTCAGGG + Intergenic
1004454519 6:15779528-15779550 GGAAAGCCTCAGACTGCTCCTGG + Intergenic
1006093419 6:31641568-31641590 GGCAACCCACACATTGATCACGG - Exonic
1006472383 6:34236227-34236249 GGAAGGCTCCACCTTGATCATGG + Intergenic
1009396772 6:63207820-63207842 GGAAAGCCTCAGAATTATCATGG - Intergenic
1013139451 6:107317403-107317425 GGAGAGCCCCAGAGTGATGAGGG + Intronic
1014460256 6:121686655-121686677 GCTAAGCCCCTCACTGACCAGGG + Intergenic
1014762851 6:125377045-125377067 GCATAGCTCAACACTGATCAAGG - Intergenic
1019380883 7:722753-722775 GGAAAGCCACAACCTGAACATGG - Intronic
1019635312 7:2072367-2072389 GGAAAGCCCTACACTGACACTGG + Intronic
1031126225 7:117776216-117776238 GGAATGCCCCAGAATGAACATGG - Intronic
1031158847 7:118142409-118142431 GGAAAAGTCCACACTGAGCAGGG - Intergenic
1033731941 7:144188597-144188619 TGAATGCCCCACACTTAACAGGG - Intronic
1033742790 7:144287180-144287202 TGAATGCCCCACACTTAACAGGG - Intergenic
1033751112 7:144362434-144362456 TGAATGCCCCACACTTAACAGGG + Intronic
1035391618 7:158508220-158508242 GGACAGCCCCACGCTGGGCAGGG + Intronic
1037985855 8:23290143-23290165 GGAGACCCCAACTCTGATCAGGG + Exonic
1038393760 8:27231254-27231276 GGAAAGATCCACCCTGAGCATGG - Intergenic
1040295035 8:46144657-46144679 GGAAGGCCCCACAATGAAAACGG - Intergenic
1042169491 8:65978036-65978058 GCTAAGCCCCTCACTGACCAGGG + Intergenic
1043961161 8:86420163-86420185 GGAATGCCGCACAATGATAAAGG + Intronic
1049826488 8:144671999-144672021 AGAAAGCCCCACACTGTTCCTGG + Intergenic
1052880289 9:33597715-33597737 GATGAGGCCCACACTGATCAGGG - Intergenic
1053495685 9:38546503-38546525 GATGAGGCCCACACTGATCAGGG + Intronic
1053512347 9:38699201-38699223 GGTAAGCCCCGGACTTATCAAGG - Intergenic
1056585792 9:87926315-87926337 GACGAGGCCCACACTGATCAGGG + Intergenic
1056611090 9:88126628-88126650 GACGAGGCCCACACTGATCAGGG - Intergenic
1057675613 9:97134018-97134040 GATGAGGCCCACACTGATCAGGG + Intergenic
1057878749 9:98777387-98777409 GAAAAGCCCCACACTCACCATGG + Exonic
1187940423 X:24375778-24375800 GGAAAGCCACACACTCAGCCTGG + Intergenic
1188312641 X:28636619-28636641 TGAAAGCCACACACTAACCATGG - Intronic
1189909691 X:45797677-45797699 TGAAAGGCCCACACTGAGGATGG + Intergenic
1193490991 X:82146976-82146998 GGAAAACCTCACACACATCAGGG + Intergenic
1195451660 X:105020771-105020793 GGGAAACCCCACACTTCTCATGG + Intronic
1195713414 X:107794328-107794350 GGAAAGCTCCACATTGAATATGG + Exonic
1195752803 X:108174813-108174835 GGAAAGCAGCACAGTGCTCAGGG + Intronic
1199920623 X:152399077-152399099 GTAAAGACTCACACAGATCAGGG + Intronic
1201708963 Y:16968229-16968251 GGAAGGCCACACATTTATCAGGG - Intergenic