ID: 1142312153

View in Genome Browser
Species Human (GRCh38)
Location 16:89320440-89320462
Sequence GACTCACGCCCTGTGCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142312145_1142312153 24 Left 1142312145 16:89320393-89320415 CCCTTGAATCAGCAGGAAACTGA No data
Right 1142312153 16:89320440-89320462 GACTCACGCCCTGTGCTGAGCGG 0: 1
1: 0
2: 0
3: 9
4: 128
1142312151_1142312153 -5 Left 1142312151 16:89320422-89320444 CCTCAGGCCACTGGGGCTGACTC 0: 1
1: 0
2: 3
3: 21
4: 257
Right 1142312153 16:89320440-89320462 GACTCACGCCCTGTGCTGAGCGG 0: 1
1: 0
2: 0
3: 9
4: 128
1142312146_1142312153 23 Left 1142312146 16:89320394-89320416 CCTTGAATCAGCAGGAAACTGAA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1142312153 16:89320440-89320462 GACTCACGCCCTGTGCTGAGCGG 0: 1
1: 0
2: 0
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142312153 Original CRISPR GACTCACGCCCTGTGCTGAG CGG Intronic
900183986 1:1324573-1324595 GAGTCACGCCCTTGGGTGAGTGG - Exonic
900345034 1:2206410-2206432 GACAGACGCCCTGGGCTGGGAGG + Intronic
900427587 1:2587547-2587569 GACTCAGCCCCTCTTCTGAGGGG + Intronic
912758556 1:112345887-112345909 GACTCAGTCACTGTGCTGCGAGG - Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915447436 1:155981962-155981984 GACCCATGGCCTGTGGTGAGAGG + Intronic
915720245 1:157979199-157979221 GACTGAGGCCCTGTGTGGAGCGG - Intergenic
917529037 1:175816407-175816429 AACTCACGACCTGTGGTGTGGGG + Intergenic
918045338 1:180937794-180937816 CCCTCCCACCCTGTGCTGAGTGG + Intronic
920274440 1:204793585-204793607 GAGTCACCCCCTGAACTGAGAGG - Intergenic
922466216 1:225846871-225846893 GGCTCAGGCCCTTGGCTGAGTGG - Exonic
923041598 1:230323691-230323713 GTCTCACGGGCTGTGGTGAGGGG - Intronic
1071959716 10:90798456-90798478 GACTCATGCCTGGTGCTGGGAGG + Intronic
1076848780 10:133082842-133082864 GACGCAGGCCCTGTGCGGTGAGG + Intronic
1078793495 11:14568990-14569012 GACTCCAGGCCTGTGATGAGAGG + Intronic
1079775648 11:24522510-24522532 GACTCACACCCTGTCCTCAAAGG - Intronic
1081847905 11:46253781-46253803 GACTCACGCCCAGTGAAGATGGG + Intergenic
1083311275 11:61785028-61785050 GTCCCAGGCCCTGTGCTGGGTGG + Intronic
1083686540 11:64379389-64379411 GATTCACACTCCGTGCTGAGAGG - Intergenic
1083758917 11:64805389-64805411 GACTCCCTCCCTCAGCTGAGGGG - Intronic
1083860861 11:65419259-65419281 GACCCAGGCCCTGAGCTGAGGGG + Intergenic
1088727146 11:112649263-112649285 GCCTCAAACACTGTGCTGAGAGG + Intergenic
1091328736 11:134713751-134713773 GATTCACCCCATGTGCAGAGTGG + Intergenic
1092845649 12:12582446-12582468 GTCTCCGGCACTGTGCTGAGTGG + Intergenic
1096589357 12:52647184-52647206 GATTCAGGCCCTGTGATGTGAGG - Intronic
1103927204 12:124429606-124429628 GACTCACCTCCTGCTCTGAGAGG + Exonic
1113868158 13:113542728-113542750 ATCTCAGACCCTGTGCTGAGTGG - Intronic
1114483382 14:23048567-23048589 GACAGAAGCCCTGTGCTTAGGGG + Intronic
1121486442 14:94320082-94320104 GTTTCAGGCCCTGTGCTGTGTGG + Intronic
1121711603 14:96042831-96042853 GACTCAGGCACTGTGTGGAGTGG - Intronic
1122494015 14:102139494-102139516 GTCTCCCGCCCTGCCCTGAGGGG - Exonic
1124243684 15:28052414-28052436 TAATCACGCCTTCTGCTGAGAGG + Intronic
1126122182 15:45263385-45263407 GACTGAGGTCCTGTGCTCAGAGG - Intronic
1127576539 15:60297345-60297367 GACTCAAGCCCTGTCATGTGAGG + Intergenic
1128513485 15:68327663-68327685 GACTCACACCCACTTCTGAGCGG + Intronic
1128606618 15:69041054-69041076 GTCTCCTGCCCTGAGCTGAGAGG + Intronic
1129109364 15:73328728-73328750 GACTCATTCTCTGTGGTGAGGGG + Intronic
1129814286 15:78538469-78538491 GACCCAGGCACTGTGCTGTGAGG - Intergenic
1129906761 15:79193226-79193248 GACTCGCTCCCTGTGTGGAGTGG - Intergenic
1130030932 15:80312982-80313004 GTCACACGCCCAGTGCTGATTGG - Intergenic
1132867281 16:2099756-2099778 GACACATGCCCCGTGCTGTGTGG + Exonic
1134524493 16:14933359-14933381 GACACACGCCCCGTGCTGTGTGG - Intronic
1134548407 16:15127582-15127604 GACACATGCCCCGTGCTGTGTGG + Intronic
1134660825 16:15983254-15983276 GACTCAGGGCCTTTGCAGAGTGG - Intronic
1134712082 16:16331846-16331868 GACACACGCCCCGTGCTGTGTGG - Intergenic
1134719939 16:16375139-16375161 GACACATGCCCCGTGCTGTGTGG - Intergenic
1134947487 16:18336746-18336768 GACACATGCCCCGTGCTGTGTGG + Intergenic
1134954747 16:18376848-18376870 GACACACGCCCCGTGCTGTGTGG + Intergenic
1135388438 16:22066596-22066618 GACTCTCAGCCTTTGCTGAGGGG - Intronic
1140172159 16:72617139-72617161 CACTCACGCACTGTTCTAAGAGG + Intergenic
1141986789 16:87585445-87585467 GACTCCCCGCCAGTGCTGAGGGG - Intergenic
1142312153 16:89320440-89320462 GACTCACGCCCTGTGCTGAGCGG + Intronic
1144671230 17:17133739-17133761 GACTCCCGCCCTCAGCTGAAAGG - Intronic
1144702640 17:17349057-17349079 GCTCCACGCCCTGTCCTGAGAGG + Intergenic
1145235151 17:21202749-21202771 TCCTCACTCCCTGTGCTGGGGGG - Intronic
1147608257 17:41786264-41786286 GACTCTCGCCCTGGGCTGGCGGG - Intronic
1149411721 17:56415097-56415119 GACTCACAGCCTTTGCTGACTGG + Intronic
1151400995 17:73855984-73856006 GACCCACTCCCTGTCCTCAGGGG - Intergenic
1152063663 17:78097953-78097975 TACTCACTCCCTGAGCTGGGAGG + Intronic
1155461540 18:26090168-26090190 GACACACGCCCTTCCCTGAGCGG + Intronic
1156651068 18:39227890-39227912 GCCTCCAGCCCTGTGATGAGAGG - Intergenic
1160539120 18:79610821-79610843 GACTCACGCCCATTCCGGAGTGG - Intergenic
1161547623 19:4891352-4891374 GCTTCACGCCCAGTGCAGAGCGG - Exonic
1163676279 19:18656795-18656817 CACTCCCGCCCTGTGCTGGGAGG - Intronic
1163713847 19:18862910-18862932 GGCTCTCTCCCTGTGCTGGGTGG - Intronic
1165731832 19:38150875-38150897 GACACAGGCCCTGTGCTCTGGGG - Intronic
1166197878 19:41218894-41218916 GCGTCACGGCCTGAGCTGAGAGG + Intergenic
925780474 2:7377239-7377261 GACTCAGGCCCTGCCCTTAGAGG + Intergenic
929544185 2:42844990-42845012 GACTCACGCTCTGTGCTCGGTGG - Intergenic
929544826 2:42848990-42849012 GACTCACACCCTATGGTGAAAGG + Intergenic
930149427 2:48043524-48043546 GACTCACGCCCAGTCCTCAAGGG - Intergenic
930442964 2:51432150-51432172 GCCTCAGGGCCTGTGTTGAGAGG - Intergenic
930555381 2:52888714-52888736 GCCTCACTGCCTGTGCTGAATGG + Intergenic
932319358 2:70809732-70809754 GACTCACGCTTTGTTCTGGGCGG + Exonic
948664631 2:239527173-239527195 TACTCACATCCTGTGCTGCGTGG + Intergenic
1169858208 20:10125963-10125985 GACTCAGGCCATGTTCTCAGAGG + Intergenic
1172870012 20:38130014-38130036 CACTCACCCCCTTTGCTGTGAGG - Exonic
1174295052 20:49539907-49539929 GTCTGTCTCCCTGTGCTGAGAGG - Intronic
1174525601 20:51168141-51168163 GCCTCACCCCCAGTGCTCAGGGG + Intergenic
1175406234 20:58731598-58731620 TACCCACTCCCTGTGCTGTGGGG + Intergenic
1175950261 20:62579976-62579998 GACTGAGGCCATGTGCTCAGGGG - Intergenic
1180054989 21:45352996-45353018 GGCTGACACCCTGTGCTGCGAGG - Intergenic
1183264280 22:36816105-36816127 GTCTCTAGCCCTGTGCTGAGGGG - Intronic
1184157581 22:42678510-42678532 GCCTCAGGTCCTGTGATGAGAGG - Intergenic
1184282935 22:43449312-43449334 GACTGAGGCCCAGTGCGGAGAGG + Intronic
950648002 3:14389182-14389204 GACTCCGGCCCTGTGCAGGGTGG - Intergenic
952842613 3:37661080-37661102 TACTCAGGCCCTTTGCTGTGTGG - Intronic
953042865 3:39270109-39270131 GACTCGGGCCCTGGGCTTAGGGG + Intronic
953415128 3:42711387-42711409 GGCTTTCGCCCTCTGCTGAGAGG + Intronic
954760656 3:52871296-52871318 GACTCACACCCTGGGCAGAGAGG + Intronic
957040229 3:75330580-75330602 GGCTCAGGCCCTCTGCTCAGGGG + Intergenic
959507878 3:107176009-107176031 GACTCAGGGCCTGTGATGGGAGG - Intergenic
961045023 3:123702160-123702182 GGCTCAGGCCCTCTGCTCAGGGG + Intronic
963123530 3:141795428-141795450 GCCTCAGGCCTTGTGCTGCGAGG - Intronic
964342017 3:155717727-155717749 GTCTCAGGGCCTGTGATGAGAGG + Intronic
964769112 3:160205812-160205834 TACTCACGCCCTGTTTGGAGAGG - Intergenic
965777092 3:172242683-172242705 GCCTCAGGGCCTGTGATGAGAGG + Intronic
967306148 3:188061378-188061400 GACTCACTTCCTGTCCTAAGTGG - Intergenic
970190291 4:13509664-13509686 GCCTCAGGGCCTGTGATGAGGGG - Intergenic
972934735 4:44119486-44119508 GACTCACTCCCTTTGCTCATTGG - Intergenic
975655558 4:76637932-76637954 GACTCAATTCGTGTGCTGAGTGG + Intronic
977874101 4:102129153-102129175 GTCTCCAGGCCTGTGCTGAGAGG - Intergenic
982566917 4:156997147-156997169 GCCTCAGGGCCTGTGATGAGAGG + Intergenic
984520463 4:180795970-180795992 GTCTCACGTCCTGTGATGGGGGG - Intergenic
985570969 5:644685-644707 CCCTGACACCCTGTGCTGAGGGG - Intronic
985632528 5:1021429-1021451 GACTGAGGCCCTGTGGGGAGGGG - Intronic
985719079 5:1480001-1480023 GACTCAGGGCCTGTGCTGCCTGG - Intronic
986239990 5:5952164-5952186 CACCCAGGCCCTGTGCTGACAGG + Intergenic
990863860 5:60358623-60358645 GACTCAGGCCCTGGGATGACAGG - Intronic
991465618 5:66909313-66909335 AACTCACTCCCTGTCCTCAGTGG + Intronic
996350487 5:122535558-122535580 GACTCTCAGCCTGTGCTAAGGGG + Intergenic
998397719 5:141829766-141829788 GACCCACACCCTGTGCAGACTGG + Intergenic
1002691163 5:181051896-181051918 GAGTCACGCCCTCTGTAGAGGGG - Intronic
1003986296 6:11438349-11438371 AACTCCAGCCCTGTGCTGATGGG - Intergenic
1004158787 6:13195039-13195061 GACTGACCCCTTGTGGTGAGAGG - Intronic
1007239243 6:40413376-40413398 GGCCCAGGCCCAGTGCTGAGTGG - Intronic
1011519911 6:88194187-88194209 CACACACGCTCTGTACTGAGTGG + Intergenic
1016271278 6:142293249-142293271 GACTCAAGCCCTGAGGTTAGAGG - Intergenic
1018743559 6:166747936-166747958 GACACAGGCACTGTGCAGAGGGG + Intronic
1018974505 6:168554909-168554931 AGCACACGCCCTGTGGTGAGAGG - Intronic
1019196867 6:170288232-170288254 GACTCACGCTCTGTGCAGTAGGG + Exonic
1021744111 7:23721657-23721679 GACTCCCTCCCTGTGCTGTCAGG - Intronic
1024232360 7:47372243-47372265 GGCTCATGCTCTGGGCTGAGTGG - Intronic
1024660098 7:51485288-51485310 GACTCACTTCCTGTGCTGGGTGG + Intergenic
1032517128 7:132515016-132515038 GACCCCCGTTCTGTGCTGAGTGG - Intronic
1035011529 7:155721274-155721296 GCCACAGGCCCTGTGCAGAGAGG + Intronic
1038387212 8:27159808-27159830 GACTCTAGCTCTGTGCTGGGAGG - Intergenic
1040775180 8:51034298-51034320 GACTCACTCCCTAGCCTGAGTGG + Intergenic
1041629958 8:60076087-60076109 GACTCACATCCTGTGCATAGTGG + Intergenic
1042728385 8:71903354-71903376 GCCTCAGGGCCTGTGATGAGAGG + Intronic
1043084256 8:75808686-75808708 GACACACGCCCTCTTCTGATAGG - Intergenic
1044282660 8:90374867-90374889 GACTCTGGGCCTGTGATGAGAGG + Intergenic
1049276667 8:141723490-141723512 GCCTCACGCCCTGGGCAGGGTGG - Intergenic
1053165528 9:35841391-35841413 GTCTCCCGCTCTGTGCTGGGAGG - Intronic
1061374432 9:130215675-130215697 AACCCAGGCACTGTGCTGAGAGG - Intronic
1186448017 X:9648434-9648456 TCCTCATGCCCTGGGCTGAGGGG + Intronic
1197290111 X:124645316-124645338 GATTCCTGCCCTGTGCTGTGTGG - Exonic
1199758466 X:150887059-150887081 GCCTCAAGCCCTGGGCTCAGGGG - Intronic