ID: 1142313635

View in Genome Browser
Species Human (GRCh38)
Location 16:89329173-89329195
Sequence CAGGCGGGGACTCCGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142313621_1142313635 18 Left 1142313621 16:89329132-89329154 CCACGGCTTCCTCCAGGACAAAA 0: 1
1: 0
2: 0
3: 20
4: 166
Right 1142313635 16:89329173-89329195 CAGGCGGGGACTCCGTGAGGAGG No data
1142313623_1142313635 6 Left 1142313623 16:89329144-89329166 CCAGGACAAAACCACCAACCTCG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1142313635 16:89329173-89329195 CAGGCGGGGACTCCGTGAGGAGG No data
1142313628_1142313635 -5 Left 1142313628 16:89329155-89329177 CCACCAACCTCGGGGAAACAGGC 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1142313635 16:89329173-89329195 CAGGCGGGGACTCCGTGAGGAGG No data
1142313620_1142313635 19 Left 1142313620 16:89329131-89329153 CCCACGGCTTCCTCCAGGACAAA 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1142313635 16:89329173-89329195 CAGGCGGGGACTCCGTGAGGAGG No data
1142313622_1142313635 9 Left 1142313622 16:89329141-89329163 CCTCCAGGACAAAACCACCAACC 0: 1
1: 0
2: 1
3: 26
4: 231
Right 1142313635 16:89329173-89329195 CAGGCGGGGACTCCGTGAGGAGG No data
1142313630_1142313635 -8 Left 1142313630 16:89329158-89329180 CCAACCTCGGGGAAACAGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 53
Right 1142313635 16:89329173-89329195 CAGGCGGGGACTCCGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142313635 Original CRISPR CAGGCGGGGACTCCGTGAGG AGG Intronic
No off target data available for this crispr