ID: 1142313744

View in Genome Browser
Species Human (GRCh38)
Location 16:89330111-89330133
Sequence GAATGACATTAAACATTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 431}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142313744 Original CRISPR GAATGACATTAAACATTTAA AGG Intronic
900328105 1:2120781-2120803 GACTGAAATTAATAATTTAAAGG - Intronic
900921057 1:5670975-5670997 AACTGACATTATACATTTTATGG + Intergenic
901523463 1:9803846-9803868 CAATGACATCAGCCATTTAAAGG + Intronic
903288953 1:22295489-22295511 AAATGAAATAAAACATGTAAAGG - Intergenic
905228895 1:36499551-36499573 AAATGAAATAAAACATATAAAGG - Intergenic
905745720 1:40415685-40415707 GAAAGACTTGAAACCTTTAATGG + Intronic
905839865 1:41166379-41166401 GAATGACATTAGAATTTTGATGG + Intronic
906390951 1:45415715-45415737 TAATGACAGTAAATATTTTACGG - Intronic
906483303 1:46215567-46215589 GAATGGCATTAGATTTTTAAAGG + Intronic
908117052 1:60950719-60950741 GAGTGACAGTCAACATTGAAGGG + Intronic
908409134 1:63845119-63845141 GCATGACATTAAACATTTCAGGG - Intronic
908936337 1:69381623-69381645 GAATGATAGTAAGCATTTAATGG - Intergenic
909306241 1:74081833-74081855 CAATGATATTAATTATTTAAGGG - Intronic
909764674 1:79340881-79340903 TAATAACATTAAATATTTAGTGG - Intergenic
909893948 1:81042297-81042319 GAGTAACATTAAAAGTTTAAAGG - Intergenic
910037756 1:82808597-82808619 TAATGACATTAAAGATCTCATGG - Intergenic
910372823 1:86536098-86536120 GAGTGAAATAAAATATTTAAAGG - Intergenic
910422136 1:87077459-87077481 GGATGTCATTAAACCTTAAATGG - Intronic
910426139 1:87121563-87121585 ACATGACCATAAACATTTAAGGG - Intronic
910950668 1:92644364-92644386 GAATGACATTAACTTTTTACAGG - Intronic
911913328 1:103663981-103664003 CAATTACTTTAAAAATTTAAAGG - Intronic
911915124 1:103687966-103687988 CAATTACTTTAAAAATTTAAAGG + Intronic
911920743 1:103758119-103758141 CAATTACTTTAAAAATTTAAAGG - Intronic
911955523 1:104229237-104229259 AAATGACATTGAATATTTTATGG + Intergenic
912125705 1:106534982-106535004 AAATGAGATAAAACATTGAAAGG - Intergenic
912622021 1:111171049-111171071 GAAAGACATTAAAAATTTGTGGG + Intronic
912784947 1:112593154-112593176 GAATAAGATAAAATATTTAAAGG - Intronic
913377857 1:118174206-118174228 GAATGCAATTAAAGAATTAAAGG + Intronic
914320423 1:146554329-146554351 GAATTACAATAAACTCTTAAAGG - Intergenic
916753847 1:167749153-167749175 GACTTACTGTAAACATTTAATGG - Intronic
919390319 1:196976285-196976307 GAGAGAAATTTAACATTTAATGG - Intergenic
919506607 1:198406678-198406700 GAAGCAATTTAAACATTTAAAGG + Intergenic
920239231 1:204532103-204532125 GAAATACATTTAATATTTAACGG + Intronic
920405997 1:205711501-205711523 GAGTTACATCAAAGATTTAATGG - Intergenic
920819901 1:209370566-209370588 GACTGACATTCAGCATTTGAAGG + Intergenic
921100827 1:211928134-211928156 GAAAGAAATAAAACATTAAATGG - Intergenic
922914631 1:229246758-229246780 GAATTACATTAAAAATTAATAGG + Intergenic
923228043 1:231957381-231957403 TAATGACAATAAGGATTTAAGGG - Intronic
924176610 1:241397764-241397786 GTTTGACATTCATCATTTAAAGG - Intergenic
924861448 1:247927475-247927497 TAATCACCTTAAACATTTAGGGG + Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063504655 10:6585337-6585359 GAATGAAATTAAACAAGAAACGG + Intergenic
1064163121 10:12962726-12962748 AAATGACATCAAACATTACAGGG + Intronic
1064330939 10:14393285-14393307 GACAGACATTAAGCATGTAATGG - Intronic
1064378921 10:14822879-14822901 GAATCACTATAAAAATTTAAGGG - Intronic
1064848037 10:19678205-19678227 GAATGTCAGTAGTCATTTAATGG + Intronic
1066681716 10:37941418-37941440 GCAAGGCATTAAACATTAAATGG + Intergenic
1068148632 10:53103123-53103145 TAATGATATTAAATATTTAGGGG + Intergenic
1068294572 10:55052945-55052967 GACTGAAATTGAACATTTCAGGG + Intronic
1068655653 10:59573148-59573170 AAATTCCATCAAACATTTAAGGG + Intergenic
1068895589 10:62196198-62196220 AAATGACATTAAAAATCTAAAGG - Exonic
1069064873 10:63931768-63931790 GTATGATATTAACCATTTGAAGG - Intergenic
1069147645 10:64915831-64915853 GAATGACATTGAAATTTTGATGG + Intergenic
1070620385 10:78005183-78005205 GAGTGACATTAAACACTAAAGGG + Intronic
1071593098 10:86895227-86895249 GAAGGACTTTAAACAATTATGGG + Intronic
1071680978 10:87705624-87705646 TAATGACATTAAGCACTTCATGG + Intronic
1071780794 10:88842076-88842098 CAATGTCTCTAAACATTTAATGG + Intronic
1072873562 10:99147255-99147277 GAATTACATTAAACAATAAAAGG + Intronic
1073173480 10:101533871-101533893 TACTGACATTTAACATTTATTGG + Intronic
1073639190 10:105232125-105232147 GAATTCTACTAAACATTTAAGGG - Intronic
1075256163 10:120927317-120927339 GAATCACATTAAGCATTTGGTGG - Intergenic
1075843281 10:125523087-125523109 GAATGACATTAAAGCTTATATGG - Intergenic
1076090659 10:127682843-127682865 CAATAACATGAAACATTTTAAGG - Intergenic
1076458858 10:130624381-130624403 AAATGAAATTAAATCTTTAACGG + Intergenic
1076703413 10:132286338-132286360 GAATGTTAGAAAACATTTAATGG + Intronic
1079368553 11:19830743-19830765 GAAGGAAAATAAACATTAAAAGG - Intronic
1079777744 11:24555311-24555333 TGATGACATAAAACACTTAAAGG + Intronic
1080068993 11:28056323-28056345 GACTGAAATTAAAAATTTTATGG + Intronic
1080301043 11:30785272-30785294 GAATAACATTAAACATGAATAGG - Intergenic
1080647444 11:34197324-34197346 GAATGACCTTGAACAATGAACGG - Exonic
1082647420 11:55745353-55745375 AAATGTCCTTAAATATTTAAAGG + Intergenic
1082750900 11:57015799-57015821 TAATGCTATTACACATTTAATGG - Intergenic
1083555896 11:63627130-63627152 GAATAACTTAAAAAATTTAATGG - Exonic
1084243633 11:67840220-67840242 GAATGAAATTAAACATTTGCTGG - Intergenic
1084829051 11:71754358-71754380 GAATGAAATTAAACATTTGTTGG + Intergenic
1085209696 11:74764907-74764929 GATGCACATTAAACATTTACAGG + Intronic
1085588697 11:77736286-77736308 AAATGTCTTCAAACATTTAAAGG - Intronic
1086211555 11:84326730-84326752 GAATGACATTATAGATGAAAAGG - Intronic
1086526292 11:87730348-87730370 GAATGAAATAAAAGATATAAAGG + Intergenic
1086637708 11:89110486-89110508 GAATTCTATTTAACATTTAAGGG + Intergenic
1086743305 11:90394797-90394819 TAATGACTTTCAACATTTACTGG - Intergenic
1087185931 11:95195247-95195269 TAATAATATGAAACATTTAAAGG - Intronic
1087468029 11:98535007-98535029 GAAGGCAATTAAACTTTTAAAGG - Intergenic
1087651216 11:100870850-100870872 GAATAAAATTAAACATAGAATGG - Intronic
1087871473 11:103298470-103298492 AAATGACATTCAAGGTTTAATGG + Intronic
1088336659 11:108712594-108712616 GAATGACATCAATGATATAAGGG - Intronic
1089712003 11:120322212-120322234 GAAGGGCATTAAAAATTTAGAGG - Intergenic
1090370580 11:126248722-126248744 TAATGACATTAATCAATTCATGG + Intronic
1092414183 12:8277329-8277351 GAATGAAATTAAACATTTGTTGG - Intergenic
1093052796 12:14521985-14522007 GAATGAAATAAAAAATATAATGG + Intronic
1094084800 12:26577500-26577522 CAAAAACATTAAACATCTAAGGG - Intronic
1094413540 12:30192972-30192994 GAATGACCTTAAATATTACAAGG + Intergenic
1094554703 12:31486987-31487009 CAATAACTTTAAACATTCAAGGG + Intronic
1094682082 12:32675870-32675892 GAATCACATTAAACCATTATCGG - Intergenic
1095277173 12:40300146-40300168 AAATAAAATTAATCATTTAATGG + Intronic
1095829330 12:46567752-46567774 GAATTACAATAAATATTCAATGG - Intergenic
1096604073 12:52752571-52752593 GAAGGAGATAAAACATGTAATGG + Intergenic
1096800600 12:54107926-54107948 GAAAGACTTTAAACAGATAATGG - Intergenic
1097450028 12:59726627-59726649 AAATAACATTAAAAATTAAAAGG + Intronic
1097690706 12:62732029-62732051 GATTGAAATAAAATATTTAAGGG - Intronic
1098247016 12:68530371-68530393 GTATGACATTAAACCATTATTGG + Intergenic
1098340525 12:69445958-69445980 GAATGGCATTAAACTTCTCATGG - Intergenic
1098403744 12:70101948-70101970 GATTAACATTAAACATTTCAAGG + Intergenic
1098508447 12:71282643-71282665 GAAGGACATTCAATATTTCAGGG + Intronic
1098633638 12:72754837-72754859 AAATGAGATTACACATATAAAGG - Intergenic
1098683567 12:73390216-73390238 AAATAACAATAAAAATTTAAGGG + Intergenic
1098809175 12:75062766-75062788 GAAAGCTATTAAATATTTAATGG + Intronic
1099525656 12:83716276-83716298 GAATTCTACTAAACATTTAAAGG + Intergenic
1099560207 12:84163995-84164017 GAAAGACATAAAAAATTAAAAGG - Intergenic
1100218771 12:92481483-92481505 GAATAACAGGGAACATTTAATGG + Intergenic
1100780136 12:98015927-98015949 GAACAACATTATACATTAAAAGG + Intergenic
1100809157 12:98320611-98320633 AAAGGAAATAAAACATTTAAGGG + Intergenic
1104011393 12:124932955-124932977 GAAAAAAATTAAACATTTAGAGG + Intergenic
1105429282 13:20322567-20322589 CAATCACGGTAAACATTTAAGGG - Intergenic
1105724858 13:23152928-23152950 GAATTATACCAAACATTTAAGGG - Intergenic
1105823175 13:24097873-24097895 GAATCAAATTAAACATGAAAGGG + Intronic
1105945765 13:25188102-25188124 CAATGTCATTATACATTTAGAGG - Intergenic
1107005870 13:35611020-35611042 GAATGACTTTAAAAATTAAAAGG + Intronic
1107053573 13:36078761-36078783 TAGTGACATAAAACATTAAAAGG + Intronic
1107790503 13:43997581-43997603 AAATGACATTAAACAGTATAAGG + Intergenic
1108290180 13:48951752-48951774 GAATAACATTGAACATGAAAGGG + Intergenic
1109019331 13:57065458-57065480 GAATGACATAAAACACTTTCAGG - Intergenic
1109525553 13:63569736-63569758 AAATGACATTCCACATTCAATGG + Intergenic
1109605676 13:64692317-64692339 GAATGAGAATTAACAGTTAATGG - Intergenic
1109711104 13:66161541-66161563 TAATCACATTAAAAATATAATGG + Intergenic
1110481234 13:75979254-75979276 GAATCACTTTCAACCTTTAACGG - Intergenic
1110576940 13:77068292-77068314 AAATGACATTATATATTTCATGG + Intronic
1113232573 13:108230328-108230350 GAGTGACATTAAACTTTGAAAGG + Exonic
1113568172 13:111333039-111333061 CAATGAGATAAAACATTCAAAGG - Intronic
1116246323 14:42417983-42418005 GAAGTACATAAAACATTAAAAGG + Intergenic
1116306127 14:43258396-43258418 TATTGACCTTAAAAATTTAACGG + Intergenic
1116577321 14:46590990-46591012 AAATGACTTTTAACAATTAATGG + Intergenic
1118544375 14:66870033-66870055 AAATGACATTACACAGTTAAGGG - Intronic
1118665700 14:68066897-68066919 AAATGACATTCAAAATTTCAGGG + Intronic
1120387584 14:83865491-83865513 GACAGACATTGAACAGTTAAAGG - Intergenic
1120719965 14:87880055-87880077 GGATGCCATTAAACCTTTAGAGG - Intronic
1124987820 15:34639436-34639458 GAATGTTAGTAAATATTTAAAGG - Intergenic
1126276107 15:46883547-46883569 AAATGACACTAGACATTTATTGG + Intergenic
1127031100 15:54863830-54863852 GCATGACTTTACACATTGAATGG - Intergenic
1127137600 15:55940742-55940764 GGATGACCTTAAACTTTTAGGGG + Intronic
1127210242 15:56766724-56766746 GAATGAGAATTAGCATTTAATGG + Intronic
1127481258 15:59379603-59379625 GAATGAAACTACACATTTCATGG + Intronic
1127943163 15:63721547-63721569 AGATGAGATTAAACATTCAAAGG + Intronic
1127947431 15:63769480-63769502 AAATGAAGTTATACATTTAATGG - Intronic
1130166825 15:81470110-81470132 AAAAGACATGAAATATTTAAGGG + Intergenic
1130606929 15:85326034-85326056 GGATTACATTAAAGATATAATGG + Intergenic
1131572304 15:93551479-93551501 TAATGACATTAATCATGGAAAGG + Intergenic
1131777801 15:95821583-95821605 GAAAGAAATTTAATATTTAAAGG - Intergenic
1131816197 15:96223723-96223745 GACAGACATTAAACAATTAATGG + Intergenic
1132320601 15:100922028-100922050 GAATAAACCTAAACATTTAATGG - Intronic
1132323838 15:100949133-100949155 GAATGACCTTAAAAATAAAAAGG + Intronic
1137005312 16:35270313-35270335 GTAAGACATTAAACATTCAATGG - Intergenic
1137230585 16:46562227-46562249 GAATGGCAGTAAATAATTAATGG + Intergenic
1137770081 16:51009139-51009161 GAATGACACTATAAAATTAAAGG + Intergenic
1138737722 16:59270416-59270438 GTATGACATTTTACATTTATTGG - Intergenic
1138889638 16:61127216-61127238 TAATCACTTTAAAAATTTAATGG - Intergenic
1139014288 16:62671151-62671173 TAATAACATTAAAAATTAAATGG + Intergenic
1139255993 16:65543256-65543278 GAATGACATTAAATATGAGATGG - Intergenic
1140013111 16:71155777-71155799 GAATTACAATAAACTCTTAAAGG + Intronic
1140494514 16:75372811-75372833 GATTTAAATTAGACATTTAAAGG - Intronic
1141056538 16:80820945-80820967 GAATGACAGAAAAGATTTCAAGG + Intergenic
1141640558 16:85338587-85338609 AAATAACATTAAATAATTAAGGG + Intergenic
1142313744 16:89330111-89330133 GAATGACATTAAACATTTAAAGG + Intronic
1144471935 17:15551413-15551435 TAATGGCTTTAAAAATTTAATGG - Intronic
1145119125 17:20240672-20240694 GGATGACATAAACCATGTAAAGG - Intronic
1145847516 17:28054739-28054761 GGAGAACATTTAACATTTAAAGG + Intronic
1147458281 17:40552298-40552320 CAATGGCATTAAATATTAAAAGG - Intergenic
1149188947 17:54034841-54034863 GAAGTACATTAAAAATTCAAGGG + Intergenic
1149511802 17:57248298-57248320 GAAAGATATTAAAAATTAAATGG + Intergenic
1149853908 17:60061905-60061927 GAATGAAATTAAAAATCGAATGG + Intronic
1150885703 17:69083052-69083074 GAATAACATTAAAAAATTAAGGG - Intronic
1153157423 18:2165484-2165506 GCATGGAATTAAACATTTTAAGG - Intergenic
1153601585 18:6785995-6786017 GGTTGACATTAAACATTTTTTGG + Intronic
1153913873 18:9728471-9728493 TCATGTCATCAAACATTTAAAGG - Intronic
1154985133 18:21543679-21543701 GAATGAGAATATACATTTGAAGG + Intronic
1157728679 18:49985342-49985364 GGATGACAGCAAACATGTAAGGG - Intronic
1157777429 18:50406628-50406650 GTAAGGCATTAAACATTCAATGG + Intergenic
1159339485 18:67117291-67117313 GAATGGCATGAAATATTTAAAGG - Intergenic
1159348944 18:67245796-67245818 GAGTGACATTAAAGTTCTAAGGG - Intergenic
1160235769 18:77085563-77085585 GAATGACAGTAAAAACATAATGG - Intronic
1160421244 18:78747112-78747134 GAATTCCATTAACCCTTTAATGG - Intergenic
1162173101 19:8806820-8806842 GAATGACATCTGACATATAAAGG - Exonic
1164062942 19:21691165-21691187 GCAAGCCATTAAACATTCAATGG - Intergenic
1165693191 19:37879803-37879825 GAATGACCTTCAACAAGTAATGG - Intergenic
1165729904 19:38138540-38138562 GAATGACAGCAAACATGGAAAGG - Intronic
1166120178 19:40681598-40681620 GGGTGACAATAAACACTTAATGG + Intronic
1168545380 19:57245382-57245404 GAAAGACATTAAAAAGGTAAAGG - Intronic
925494150 2:4427085-4427107 TAATGACATTAAAAATAAAAGGG - Intergenic
925605859 2:5659002-5659024 CAATTACGTTAAACATTAAAGGG - Intergenic
926523022 2:13941496-13941518 GAAAGACATTACAAAGTTAATGG + Intergenic
926879146 2:17522289-17522311 GAAGGGCTTTATACATTTAAGGG - Intergenic
927381023 2:22479187-22479209 GGAGGACATTAAACAATGAATGG - Intergenic
927578257 2:24218814-24218836 GAATGACTTTAAACACCTTAAGG + Intronic
929070550 2:38026031-38026053 GAATTCCACTAAACATTTAAGGG - Intronic
931603636 2:64029920-64029942 GAGAGACATTAAACAATTATAGG + Intergenic
931657952 2:64527278-64527300 CAATGAAATTAAAAGTTTAAAGG + Intronic
931889134 2:66650803-66650825 GAAAGACATGAATTATTTAATGG - Intergenic
932049350 2:68383428-68383450 GAATTTCATTAAATATTTACAGG + Intronic
932978049 2:76628598-76628620 GAATGAGATTATATATTCAAAGG - Intergenic
933159716 2:79010355-79010377 AAATTATATTAAACATTTAAAGG + Intergenic
934982642 2:98857596-98857618 GACTGACAATATACACTTAAAGG + Intronic
935662115 2:105475762-105475784 CAATGTCATAAAACAATTAATGG - Intergenic
935810253 2:106790649-106790671 GAAAGACATTTTGCATTTAAAGG - Intergenic
935895210 2:107729586-107729608 GAGTGATGTTAAACATTTCATGG - Intergenic
937187545 2:120058829-120058851 GAAAGACATTCTACATTGAATGG + Intronic
938123474 2:128651944-128651966 GAATGCCACCCAACATTTAAAGG - Intergenic
938918168 2:135964887-135964909 TAAGCACAGTAAACATTTAAAGG - Intronic
938918643 2:135971003-135971025 GAATTCTACTAAACATTTAAAGG + Intronic
939033951 2:137109152-137109174 GGAAGAAATTATACATTTAAAGG - Intronic
942028245 2:171932352-171932374 GAATGCTACTGAACATTTAAAGG - Intronic
942365040 2:175216724-175216746 GAATTCTATCAAACATTTAAAGG + Intergenic
942696290 2:178650464-178650486 AAATGACATTAAACACTAAAAGG - Intronic
943212427 2:184985054-184985076 GAATGACTTAAAATATTTTATGG + Intergenic
944053836 2:195502321-195502343 GAAAGATTTTAAACATTTGAAGG + Intergenic
944238205 2:197459882-197459904 GAGTGACAGTAAAAATTAAAAGG - Intronic
944803740 2:203260908-203260930 TAAAGACATTAAATATATAATGG - Intronic
944848758 2:203695553-203695575 CATAGACATTAAACACTTAATGG + Intergenic
944928441 2:204490612-204490634 GAATGATATTTATCATTTAATGG - Intergenic
945802343 2:214449146-214449168 GAATGCCACTAAACATTTGAGGG - Intronic
946768783 2:223065789-223065811 AAATGAGATTAAATATTAAAAGG - Intronic
946953564 2:224904173-224904195 TAATGACTTTAAAAATGTAATGG - Intronic
1169293254 20:4370919-4370941 GAAAGGCATTAAACTTCTAAAGG - Intergenic
1169429941 20:5527656-5527678 GAATTCTATTAAAGATTTAAAGG + Intergenic
1169522856 20:6391836-6391858 AAATGAGATGATACATTTAAAGG - Intergenic
1169523253 20:6395504-6395526 AAATGAGATGATACATTTAAAGG - Intergenic
1170234095 20:14082821-14082843 AAATGACAATAAACATTTGGTGG - Intronic
1170391514 20:15880088-15880110 GAATGAGATTAAAATTTGAATGG - Intronic
1171795857 20:29566430-29566452 GAAAGACTTTAAACAAATAATGG + Intergenic
1171852378 20:30317727-30317749 GAAAGACTTTAAACAGATAATGG - Intergenic
1172867985 20:38114322-38114344 GAAAGTCATGAAACATTTAAGGG + Intronic
1173007989 20:39155885-39155907 GGGGGAGATTAAACATTTAAAGG - Intergenic
1174123410 20:48284793-48284815 AAATGACATTAAAAATGTAAAGG - Intergenic
1174900864 20:54498653-54498675 AAATTACATTCAATATTTAAGGG + Intronic
1175090405 20:56498789-56498811 GAATAACATGCAACTTTTAATGG - Intronic
1177339185 21:19777863-19777885 GAATGACATTAGTAATTCAATGG + Intergenic
1177391060 21:20472666-20472688 TAAAGACATTAAAAATTTAATGG + Intergenic
1177531591 21:22365638-22365660 GAATAACATTCAACATTTTTTGG - Intergenic
1177695829 21:24569142-24569164 GAATGACATTAAAATTAAAAAGG - Intergenic
1177698012 21:24598607-24598629 CAATGAAAGTAAACATTTAGGGG + Intergenic
1177826698 21:26092321-26092343 GAATGTCATTCAACACTAAAAGG + Intronic
1178164951 21:29962844-29962866 AAATGGCATTAAGCATTGAATGG + Intergenic
1178775834 21:35549618-35549640 TAATGACCTCAAACATTTACAGG + Intronic
1184622503 22:45692361-45692383 AAATGAAAATGAACATTTAAGGG + Intronic
949099060 3:121099-121121 GGATGATATTTAACATCTAAAGG - Intergenic
949470158 3:4386187-4386209 GAATTACATTAAACAATTGGGGG + Intronic
949477404 3:4461779-4461801 GAATGACATTTGACATTTGTAGG - Intronic
949780245 3:7678531-7678553 GAATGACATTAAAAGTCTAAAGG + Intronic
950692176 3:14668349-14668371 GAATGACATTCAATATTTTTAGG + Intronic
951102507 3:18705123-18705145 GAATGGCATGACATATTTAAAGG + Intergenic
951943791 3:28111744-28111766 TAATAACTTTAAAGATTTAAGGG - Intergenic
952003118 3:28809365-28809387 GAAAGAAATTAAACCTTTTATGG + Intergenic
952119586 3:30226249-30226271 GAATGTCATTAAGAATTTAGGGG - Intergenic
952130222 3:30353333-30353355 GAATAACTTTACACTTTTAAAGG + Intergenic
953935548 3:47038707-47038729 AAATGACTGTAAACATTTAAAGG - Intronic
954805421 3:53217122-53217144 GAATTCTATTGAACATTTAAGGG + Intergenic
955013557 3:55045482-55045504 GAATTCTACTAAACATTTAAGGG - Intronic
955119834 3:56046837-56046859 GAACAACATTAAACTTTGAAAGG - Intronic
956691696 3:71884328-71884350 GAAGGACCTTGTACATTTAATGG - Intergenic
957059216 3:75468205-75468227 GAATGAAATTAAACATTTGTTGG - Intergenic
957208538 3:77230762-77230784 GAAAGACATTGAACACTTGATGG + Intronic
957360149 3:79145056-79145078 AAATGACATAAAAGATTTGAAGG - Intronic
957946698 3:87072302-87072324 TCATGTCATTAATCATTTAATGG - Intergenic
958525278 3:95250626-95250648 GAATGAAATTAAAAATTAGAAGG - Intergenic
960419721 3:117428929-117428951 GAATGAGATAAAGCATTGAATGG - Intergenic
961861492 3:129919895-129919917 GCATGACTTTAAACATATAATGG + Intergenic
961891728 3:130135949-130135971 GAATGAAATTAAACATTCGTTGG - Intergenic
962461892 3:135621781-135621803 GACTGACATTAAACAGAAAATGG + Intergenic
963846664 3:150165823-150165845 GACTGAAATTACACAGTTAAAGG - Intergenic
964141517 3:153406724-153406746 AAATGTCTTTAACCATTTAAAGG - Intergenic
964547389 3:157849278-157849300 GAAGGATATTAAACATTTTCTGG + Intergenic
964778877 3:160313252-160313274 GAATGATATAAAAACTTTAAAGG + Intronic
964789446 3:160438852-160438874 AATAGACAGTAAACATTTAATGG + Exonic
965181273 3:165406373-165406395 GAGTGGCATGAAATATTTAAAGG + Intergenic
965320907 3:167250377-167250399 GAAAGAAATTAAACGTTTTATGG - Intronic
965953232 3:174335925-174335947 GAATGACATTAAACTGCTCATGG + Intergenic
966315437 3:178639816-178639838 GAAGGACATTTAAAATTAAATGG + Intronic
966437719 3:179907262-179907284 TAATGACCTTCAACATTTAATGG - Intronic
967401329 3:189065230-189065252 GAATAATACCAAACATTTAAAGG + Intronic
969101271 4:4770010-4770032 AAATGAGATGATACATTTAATGG + Intergenic
969140005 4:5061276-5061298 GAATAACATTAAGAAGTTAATGG - Intronic
969750904 4:9110140-9110162 GAATGAAATTAAACATTTGTTGG + Intergenic
969810808 4:9646428-9646450 GAATGAAATTAAACATTTGTTGG + Intergenic
971041322 4:22755446-22755468 GAATAACATCTAACATTTTAAGG - Intergenic
971530642 4:27684235-27684257 GAAAGACATTAAACTCATAAGGG - Intergenic
971780793 4:31031892-31031914 GAAAATAATTAAACATTTAATGG - Intronic
972001581 4:34042438-34042460 GAATGACATAGAACATTACAGGG - Intergenic
973106839 4:46349466-46349488 GAATTACATTAATCATATATGGG + Intronic
973650097 4:52990777-52990799 AAAAGTCATGAAACATTTAAAGG + Intronic
974324152 4:60392352-60392374 GAATCACAGTAAACAATTCAGGG + Intergenic
974679212 4:65138968-65138990 GAATTGTATCAAACATTTAAAGG + Intergenic
974824701 4:67113021-67113043 GAAAGACATGAAACATTAAAAGG + Intergenic
974927651 4:68320855-68320877 TAATGACATTTAAGAATTAAGGG + Intronic
975231664 4:71942007-71942029 GAATGATATAAAACTTTTAAGGG + Intergenic
977603655 4:98960588-98960610 CAATCACATTAAACAGTTAAAGG + Intergenic
978279136 4:106988525-106988547 GCATGACATTAAACACTAAAAGG - Intronic
978645271 4:110923294-110923316 GAATGACATTAAATTTGCAAAGG + Intergenic
978982856 4:114970896-114970918 GAATTACCCTTAACATTTAAGGG - Intronic
979027977 4:115601551-115601573 GAATCTCATTAAAAAGTTAATGG - Intergenic
979577007 4:122304554-122304576 TAATGGTATTACACATTTAATGG + Intronic
979919823 4:126481759-126481781 GAAAGAAATTAAACCTTTTATGG - Intergenic
980655499 4:135778481-135778503 GAATGACATCAAGCATTTAGTGG + Intergenic
980848169 4:138349134-138349156 GACAGACATTAAACAATTAAGGG - Intergenic
981118604 4:141021460-141021482 GAATGACATCAGAAATCTAAGGG + Intronic
981853552 4:149259676-149259698 TAAAGAAATTAAACATTGAAAGG - Intergenic
982063779 4:151632206-151632228 GAATGACATTAATGATAAAAGGG + Intronic
984557282 4:181229878-181229900 GAATGCCAATTAACATTTAATGG - Intergenic
984772375 4:183447596-183447618 GAATGACAGTACACATTAAAAGG + Exonic
985284779 4:188325396-188325418 GAAGCATATTTAACATTTAATGG + Intergenic
986279058 5:6307837-6307859 TAATCAAATAAAACATTTAAGGG + Intergenic
987323956 5:16795256-16795278 GAAGGACATTTACAATTTAATGG + Intronic
987495886 5:18644163-18644185 GAAGGTCATTAAAAATTTAGGGG - Intergenic
987755121 5:22090774-22090796 GTATTACATTAAATATTTATTGG - Intronic
988050649 5:26025792-26025814 GAACTACATTAAATATTTAGTGG + Intergenic
988115311 5:26880513-26880535 GAATCACGTTTTACATTTAAAGG + Intergenic
988637541 5:33002508-33002530 GGCTGACATTAAAAATGTAAAGG - Intergenic
988677774 5:33451135-33451157 GAATTACATAAAACATTGATGGG + Intronic
989815408 5:45731031-45731053 GAATGACATCAAAAATACAAGGG + Intergenic
990215923 5:53531585-53531607 GAATAAATTTAAACATTTAGAGG - Intergenic
990732768 5:58827401-58827423 CAATGACATTAAACAATTCTTGG - Intronic
990816769 5:59794549-59794571 TAATTACAGTAAACATTTATAGG - Intronic
990853988 5:60241992-60242014 GAGTGACATGACACATTTACAGG + Intronic
991000075 5:61773837-61773859 GAATGACATGAATAATTCAAGGG - Intergenic
991228902 5:64307023-64307045 GGATTACATTAACCATTTTATGG - Intronic
991394063 5:66185067-66185089 GAAAGACAATAAACAGTAAAGGG - Intergenic
991730979 5:69587658-69587680 GAATCACATTAAACACTTACTGG + Intronic
991807414 5:70442819-70442841 GAGTCACATTAAACACTTACTGG + Intergenic
991863971 5:71040198-71040220 GAATCACATTAAACACTTACTGG - Intronic
992556423 5:77907640-77907662 GCCTGACATTAAACAAGTAAAGG - Intergenic
993884591 5:93400891-93400913 CAATGACATTGAACATAGAAAGG - Intergenic
993932619 5:93959531-93959553 GAATACCACTAAACTTTTAAGGG + Intronic
994541408 5:101102884-101102906 CAAACACATAAAACATTTAAGGG - Intergenic
994600848 5:101902750-101902772 GAACCACAGTAAAAATTTAAAGG + Intergenic
994631010 5:102287901-102287923 AAATTGCATTACACATTTAAAGG - Intronic
994719002 5:103359121-103359143 GAATGACAATAAAAATAGAAGGG + Intergenic
994824470 5:104695745-104695767 GGATTACACTAAAAATTTAAAGG + Intergenic
994986187 5:106936668-106936690 GAATGAGATTAACAATTGAATGG + Intergenic
995277904 5:110298483-110298505 AAAGGACATTAACAATTTAAAGG + Intronic
995682186 5:114732121-114732143 GTATCACATTAAAAGTTTAAGGG - Intergenic
995862268 5:116653300-116653322 GAATGAAAGTAAACACTTATGGG + Intergenic
996218426 5:120896931-120896953 CAATGACATTGAAAAGTTAAAGG - Intergenic
997729627 5:136158297-136158319 GAAAGACAGGAAACATATAAAGG + Intronic
999515375 5:152296932-152296954 GAATGACAAAAGACATTTTAGGG + Intergenic
1000265987 5:159638214-159638236 GAATTCTACTAAACATTTAAAGG + Intergenic
1000545461 5:162594953-162594975 GAATGAGATTTAAAATTGAATGG + Intergenic
1000777095 5:165433233-165433255 GCAAGACATAAAATATTTAATGG - Intergenic
1000961192 5:167603271-167603293 AGATGACATTAAACAATTCAAGG - Intronic
1003319043 6:5036107-5036129 GAATTACTTAAAATATTTAAGGG - Intergenic
1003745736 6:8999637-8999659 GTTTTCCATTAAACATTTAATGG + Intergenic
1004151388 6:13123446-13123468 GCAAAGCATTAAACATTTAAAGG + Intronic
1004339083 6:14791916-14791938 GAATGTAATCAAACATTTATTGG + Intergenic
1004414398 6:15412270-15412292 TAATGACACTACACATTTGAAGG - Intronic
1006291489 6:33141060-33141082 GAATGAAAATTAACATTTGAAGG - Intergenic
1006612603 6:35303454-35303476 GAATGAACTTAAACACTTCATGG - Intronic
1008018038 6:46543039-46543061 GAGTGGCATGAAATATTTAAAGG + Intergenic
1008119813 6:47599212-47599234 TAATGACATTAAAGATTGTATGG - Intronic
1008168949 6:48178724-48178746 GAAAGACATTCAACAGTTGAAGG - Intergenic
1008790870 6:55231312-55231334 TAATGAAATTAAACATGTGAAGG + Intronic
1009278413 6:61715880-61715902 TAAAGAAATTAAACATTTTAAGG - Intronic
1009725259 6:67530036-67530058 GAAAGAAATTAAACCTTGAATGG + Intergenic
1010330262 6:74615437-74615459 GAATGACCTTCAAGATTTCATGG - Intergenic
1010582549 6:77617489-77617511 GTTTGACATTAAAAATTTCAGGG + Intergenic
1012589695 6:100966174-100966196 GAATGACATTAAACATTAATTGG + Intergenic
1012783779 6:103597124-103597146 GAAGGAGACTGAACATTTAAAGG + Intergenic
1014700477 6:124680820-124680842 GTATCTCATTGAACATTTAAGGG - Intronic
1014821940 6:125999269-125999291 GAATGACATTAAGCAATAAAAGG + Intronic
1015151879 6:130049215-130049237 GAAAGTCATTAATTATTTAATGG - Intronic
1015207131 6:130652554-130652576 AAATGACTTTAAACATAAAAAGG - Intergenic
1015972643 6:138758259-138758281 GAATGACATTACAGCTTAAAGGG + Intronic
1018356656 6:163024609-163024631 GAATGACATTAAAGTTTAATAGG + Intronic
1018589865 6:165407674-165407696 GAAAGACATTTAACATGAAAGGG - Intronic
1019418736 7:939202-939224 AAATGACAGTAAATATTTTAGGG - Intronic
1019889207 7:3932517-3932539 GACTGACTTTATTCATTTAAAGG + Intronic
1020322068 7:6946499-6946521 GAATGAAATTAAACATTTGTTGG - Intergenic
1020466933 7:8490725-8490747 AAATGGCAATAAATATTTAAGGG + Intronic
1020642060 7:10767794-10767816 AAATTACATTAAATATATAAAGG - Intergenic
1021209794 7:17834769-17834791 GAATGTCATCAAAGATTTCAGGG + Exonic
1021728883 7:23577194-23577216 GCATTACAATAAACAATTAATGG + Intergenic
1021918649 7:25461037-25461059 GAATTCTATCAAACATTTAAGGG - Intergenic
1022358663 7:29639404-29639426 GCAAGACATTAAACATTCAATGG - Intergenic
1024491649 7:49992446-49992468 GAGTGAAATTAAAAATTAAATGG + Intronic
1024915740 7:54497580-54497602 GAATGAAAAGCAACATTTAATGG + Intergenic
1025787639 7:64658162-64658184 GAATGACATCAAATAGTTGATGG - Intergenic
1027660426 7:80981711-80981733 GAATAAAATAAAACATTAAAAGG - Intergenic
1028075291 7:86505429-86505451 TAACGACATTAAATATTTACTGG - Intergenic
1028271422 7:88795438-88795460 TAATAACAGTAAACATTTCAAGG + Intronic
1028698522 7:93746872-93746894 CAATGACATTCAAGATTTCAAGG + Intronic
1028773405 7:94653914-94653936 TAATGTTATTTAACATTTAAAGG + Intronic
1030230483 7:107203669-107203691 AAATCACATAAAACAGTTAAGGG + Intronic
1030969688 7:116040471-116040493 GTATCACTATAAACATTTAAAGG - Intronic
1031284402 7:119845902-119845924 GAATGACATAATAAATTAAATGG + Intergenic
1031658813 7:124394934-124394956 GAATGACATTAAAAAATTACTGG + Intergenic
1032524247 7:132567576-132567598 GAATGACCTTAAAAATATCAAGG - Intronic
1032721631 7:134554880-134554902 GCAAGGCATTAAACATTCAATGG + Intronic
1033312579 7:140272441-140272463 GAATGACACTATTCAATTAATGG - Intergenic
1033645642 7:143301113-143301135 AAATGAGATTATGCATTTAAGGG + Intronic
1033985525 7:147221168-147221190 GAATGACATTAATGATACAAGGG - Intronic
1034037684 7:147842023-147842045 TAATGATAATAAACAATTAATGG - Intronic
1035420830 7:158728087-158728109 GAATAACAGTAAATAGTTAAAGG + Intergenic
1035764498 8:2095249-2095271 GAATGACATTAAAAAGAAAATGG - Intronic
1035981993 8:4382598-4382620 GTATGACCTTTAAGATTTAATGG - Intronic
1036056804 8:5263842-5263864 GAATGAGAATAAAAATTTCATGG + Intergenic
1036144125 8:6237448-6237470 AAATGAAATTAAGAATTTAAAGG + Intergenic
1036374109 8:8185536-8185558 GAATGAAATGAAACATTTGTTGG + Intergenic
1036602189 8:10271684-10271706 AAATTACATAAATCATTTAATGG - Intronic
1036876794 8:12480103-12480125 GAATGAAATGAAACATTTGTTGG - Intergenic
1037003945 8:13753313-13753335 CAGTGACATTACACATTCAAAGG + Intergenic
1038074343 8:24054083-24054105 GAATTACATCAAATATTTAAGGG - Intergenic
1038132352 8:24746578-24746600 GACATTCATTAAACATTTAATGG + Intergenic
1038307503 8:26417830-26417852 GCATGACATCAAACATGGAATGG + Intronic
1038969360 8:32614815-32614837 TAATGACATTAAGCAAGTAAAGG + Intronic
1039391708 8:37186284-37186306 GAATGAGATTCTACATTGAATGG + Intergenic
1039716715 8:40117674-40117696 TACTTACATTAAAGATTTAATGG - Intergenic
1040022148 8:42750353-42750375 AAATGAAATTAAACATTGATTGG + Intergenic
1040662593 8:49593609-49593631 GAATGCCATTAAACATTTTAAGG + Intergenic
1042892607 8:73629627-73629649 TATTGACAGTAATCATTTAAGGG + Intronic
1043264381 8:78245178-78245200 TATTGACATTAAACATTTTCTGG - Intergenic
1043550979 8:81372342-81372364 GAATGAATTTAATCATTTTAAGG - Intergenic
1043624572 8:82240379-82240401 TAATCACATGAAACCTTTAAAGG + Intergenic
1043705482 8:83343625-83343647 GAATGACGTTAAAATGTTAAAGG + Intergenic
1044551303 8:93515485-93515507 GAATGTCATTGAACAAATAAGGG - Intergenic
1044812025 8:96072804-96072826 GAAGGCCATTACATATTTAAAGG + Intergenic
1045065974 8:98444595-98444617 GAAAGACAATGAAGATTTAAGGG + Intronic
1045104963 8:98883564-98883586 TAAGGACAATAAACATCTAAAGG + Intronic
1045128183 8:99117906-99117928 GCATAAAATTCAACATTTAAAGG - Intronic
1045209486 8:100081780-100081802 GAATGACATCAAATATTAATGGG + Intronic
1045848583 8:106666063-106666085 GAACTACATTAAAGATTTAATGG - Intronic
1046286048 8:112093688-112093710 CAATGACATTAAACATTTTTTGG - Intergenic
1047549706 8:125857012-125857034 GAATGACATTGAAAAATCAAGGG + Intergenic
1047559681 8:125973111-125973133 AAATGACATTAATCCATTAATGG + Intergenic
1047860225 8:128957865-128957887 GAAGGACATCAACCATTTCACGG - Intergenic
1048701545 8:137096489-137096511 GAATGACATTGGTAATTTAATGG - Intergenic
1050791394 9:9475305-9475327 GAATGTCATTAACCAATAAAAGG + Intronic
1052515981 9:29480437-29480459 CGATCAGATTAAACATTTAAAGG + Intergenic
1052602658 9:30656283-30656305 AAATGTCTTTAACCATTTAAAGG + Intergenic
1052754786 9:32529440-32529462 GAATTCTGTTAAACATTTAAGGG - Intergenic
1053440236 9:38110064-38110086 CAACGACAGTAAACATTTGAGGG + Intergenic
1053790163 9:41681005-41681027 GAAAGACTTTAAACAGATAATGG - Intergenic
1054154975 9:61633752-61633774 GAAAGACTTTAAACAGATAATGG + Intergenic
1054178504 9:61892694-61892716 GAAAGACTTTAAACAGATAATGG - Intergenic
1054474766 9:65564860-65564882 GAAAGACTTTAAACAGATAATGG + Intergenic
1054659025 9:67688130-67688152 GAAAGACTTTAAACAGATAATGG + Intergenic
1055070140 9:72157629-72157651 GAATGAGAGAAAACAGTTAAGGG - Intronic
1055535437 9:77237662-77237684 AAATAAAAATAAACATTTAAAGG - Intronic
1056188067 9:84156129-84156151 GAATGACATTAAACAAATATGGG + Intergenic
1056319905 9:85426235-85426257 GAATGACGATGAACATTAAAAGG + Intergenic
1057250656 9:93498645-93498667 GAATGACATTAAAACTTTCAGGG - Intronic
1058382409 9:104392070-104392092 TAATTAGATTAAACATTTGAAGG + Intergenic
1058608460 9:106749179-106749201 GAAAGTCATTAAACATTTTATGG + Intergenic
1059365275 9:113781912-113781934 GAATGACATGAAATATAGAATGG - Intergenic
1059410426 9:114128597-114128619 AAATTACATTATACATTTATGGG + Intergenic
1059465789 9:114468000-114468022 CAATGAGATAACACATTTAAAGG - Intronic
1059680038 9:116576959-116576981 CAATAACAGTAAACATTTATAGG + Intronic
1060370242 9:123062394-123062416 GAATGACATTAAATTTGAAAAGG - Intronic
1062661553 9:137637760-137637782 GAATTATACCAAACATTTAAAGG - Intronic
1062695305 9:137872573-137872595 GAATGACATTAAATGTTCATTGG + Intergenic
1186017060 X:5209111-5209133 GAATGCCATTACACTTCTAAAGG - Intergenic
1186724177 X:12339065-12339087 GATTGTCAGTAAACAATTAAGGG + Intronic
1187527402 X:20066573-20066595 GAACGTCATCAAAAATTTAAAGG + Intronic
1187659068 X:21518008-21518030 GATTCACATTAAAATTTTAAAGG - Intronic
1188088410 X:25931543-25931565 GAAAGACATTAAAGATTTTTGGG - Intergenic
1188394873 X:29669433-29669455 GAATAACATTAATAACTTAAGGG - Intronic
1188478302 X:30610782-30610804 AAATGAAATAAAACATATAAAGG - Intergenic
1188773794 X:34188461-34188483 GAATTTTACTAAACATTTAAAGG - Intergenic
1188922797 X:35999311-35999333 GAATTACATACAACATTTAAAGG - Intergenic
1191212828 X:57907588-57907610 GTTTTACATTAAAAATTTAATGG - Exonic
1192419853 X:71020063-71020085 GATTGACATTTAACATTGAGAGG - Intergenic
1192550286 X:72048145-72048167 GCATTACACTAAACATTTATTGG + Intergenic
1192855419 X:75005099-75005121 GAATGACATCAAGCAATTCATGG + Intergenic
1192977786 X:76304196-76304218 GAGTGACATGACATATTTAAAGG - Intergenic
1193731119 X:85105126-85105148 GAATTGCATTAAACTTTTAATGG + Intronic
1193756589 X:85417051-85417073 GAGTGACATGACATATTTAAAGG - Intergenic
1194698468 X:97084721-97084743 GAATGACAATAAACTAGTAAGGG + Intronic
1194874721 X:99172907-99172929 TAATGCTATTATACATTTAATGG - Intergenic
1195480970 X:105344504-105344526 CAATGATATTGAACATTTATGGG - Intronic
1195828684 X:109032008-109032030 GAGTGACATGACATATTTAAAGG - Intergenic
1196699096 X:118646672-118646694 GTATGAAAATAAACATTTAAGGG - Intronic
1196971479 X:121113956-121113978 TAATGATATTACACACTTAATGG - Intergenic
1197554795 X:127939707-127939729 GAATGATATAAAGCATTGAATGG - Intergenic
1197840434 X:130740529-130740551 AAATGGAATTAAGCATTTAAAGG + Intronic
1197844702 X:130789086-130789108 GAATGACATTTCTCATCTAATGG + Intronic
1199237143 X:145505011-145505033 GATTCACGTTAAACATCTAAGGG + Intergenic
1199412440 X:147539994-147540016 TAATGAAATTAAAACTTTAAAGG + Intergenic
1199748517 X:150792408-150792430 GGATAACATGGAACATTTAAAGG - Intronic
1201393200 Y:13520851-13520873 GAAGGTCATTAAACAGTTACAGG + Intergenic
1201643501 Y:16202739-16202761 GTGAGACATTAAACATTCAATGG + Intergenic
1201659314 Y:16382582-16382604 GTGAGACATTAAACATTCAATGG - Intergenic
1201988631 Y:19998169-19998191 TAGTGACATTGAACATTTAGGGG - Intergenic
1202101793 Y:21316801-21316823 TAACAAAATTAAACATTTAAAGG + Intergenic