ID: 1142314347

View in Genome Browser
Species Human (GRCh38)
Location 16:89334250-89334272
Sequence ATTGTGAAGGCCATTGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142314347_1142314358 24 Left 1142314347 16:89334250-89334272 CCCTCATCAATGGCCTTCACAAT 0: 1
1: 0
2: 2
3: 30
4: 244
Right 1142314358 16:89334297-89334319 CAGTGAGTGTACTGCCAATACGG 0: 1
1: 0
2: 0
3: 4
4: 69
1142314347_1142314351 -9 Left 1142314347 16:89334250-89334272 CCCTCATCAATGGCCTTCACAAT 0: 1
1: 0
2: 2
3: 30
4: 244
Right 1142314351 16:89334264-89334286 CTTCACAATCCCTGCTGACTGGG 0: 1
1: 0
2: 0
3: 9
4: 180
1142314347_1142314350 -10 Left 1142314347 16:89334250-89334272 CCCTCATCAATGGCCTTCACAAT 0: 1
1: 0
2: 2
3: 30
4: 244
Right 1142314350 16:89334263-89334285 CCTTCACAATCCCTGCTGACTGG 0: 1
1: 0
2: 1
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142314347 Original CRISPR ATTGTGAAGGCCATTGATGA GGG (reversed) Intronic
902803210 1:18844144-18844166 ATTCTGAAGGACAGTAATGATGG + Intronic
904373211 1:30063847-30063869 ATTGTTCAGTCCAATGATGAGGG + Intergenic
904775947 1:32906629-32906651 CATGTGAAGGCCACTGAGGATGG - Intergenic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
907142269 1:52198830-52198852 ATTGTGGAGGATATTGATAATGG - Intronic
907649288 1:56278998-56279020 ATTCTGCAGTCCATGGATGAAGG - Intergenic
907733877 1:57092960-57092982 ATTGAGAAGGCGATGGAAGAGGG + Intronic
907858848 1:58330924-58330946 ATTCTGCAGTCCATTGATGAAGG + Intronic
909220248 1:72949959-72949981 ATTCTGCAGGCCATGGATCAAGG - Intergenic
910305595 1:85759948-85759970 TTTGGGAAGGCAATTAATGAGGG + Intronic
910545665 1:88414191-88414213 ATTGTGAAACCCATGGATCATGG - Intergenic
912032800 1:105270811-105270833 CTAGTTAAGACCATTGATGAAGG + Intergenic
912859570 1:113201384-113201406 ATTCTGTAGCCCATTGATCAAGG + Intergenic
912937496 1:114016373-114016395 TTTGTGTAGGCCATTGATAATGG - Intergenic
915889496 1:159759254-159759276 ATCGTGAAGAACATTGATGATGG + Intergenic
916169576 1:161991317-161991339 ATTCTGAAGCCCATGGATTAAGG - Intronic
917625643 1:176843325-176843347 AGTGTGAATACCATTGGTGATGG + Exonic
918817318 1:189205224-189205246 ATTTAGAAGACCATGGATGAGGG - Intergenic
920081344 1:203375616-203375638 ATTCTGAAGCCCATGGATTAAGG - Intergenic
920578431 1:207081425-207081447 TTGGTGAAGGTCATTCATGAGGG - Intronic
920989532 1:210923448-210923470 ATTGTGGTGGCCACTGAGGAAGG - Intronic
922610830 1:226926122-226926144 ATTGTAAAGACCATCGATGCTGG - Intronic
924580345 1:245317918-245317940 TTTTTCAAGGCCATTGAAGACGG - Intronic
1064918481 10:20488870-20488892 AATGTGAAAGCCATTGACTAGGG - Intergenic
1065341134 10:24706989-24707011 AGTGTGAGCGTCATTGATGATGG - Intronic
1065746659 10:28848485-28848507 ATTTTGAAGGCGCTTGATCAAGG + Intronic
1068281562 10:54877771-54877793 ATATTGAATGCCATTGAGGAAGG - Intronic
1069194256 10:65528694-65528716 ATTCTGAAGTAAATTGATGATGG + Intergenic
1072850439 10:98884887-98884909 ATTCTGAAGCCCATGGATCAAGG + Intronic
1073737434 10:106365807-106365829 AGTGTGAAGGCCATTTATCCAGG + Intergenic
1073763807 10:106659741-106659763 AATGCCAAGGCCATTGATGTGGG + Intronic
1073927580 10:108534629-108534651 ATTGTAAAGACCATTGATGCTGG + Intergenic
1075354644 10:121760210-121760232 ATTCTGAAGCCCATGGATCAAGG + Intronic
1076488995 10:130843933-130843955 ATTGCCAAAGCCATTGATGTGGG + Intergenic
1078633491 11:13027965-13027987 ATTGTGGAGGCCAGGGATGGTGG + Intergenic
1078975767 11:16474450-16474472 ATTCTGTAGGCCATGGATCAAGG - Intronic
1079003940 11:16779555-16779577 ATTGTGAAGGCCACATTTGAGGG - Intronic
1079611117 11:22433481-22433503 ATTGTTAAAGGCAGTGATGATGG + Intergenic
1079944330 11:26722817-26722839 ATGGAGAAGGCCACTGAAGAAGG - Intronic
1080215650 11:29836981-29837003 ATGGTGATGGCGACTGATGATGG - Intergenic
1080295107 11:30717707-30717729 ATGGTGAAGGTCATGGCTGATGG + Intergenic
1085367087 11:75958846-75958868 ATTCTGTAGCCCATGGATGAAGG - Intronic
1086318693 11:85621344-85621366 ATTCTGCAGGCCACAGATGAAGG + Intronic
1086373886 11:86181109-86181131 ACTGTAAAGGCCATTGTTGTGGG + Intergenic
1086941245 11:92800724-92800746 TTTGTGAGGGCCCTTGATGGTGG + Exonic
1087909480 11:103736786-103736808 ATTGAGAAGGCTCTTGATGCTGG - Intergenic
1089056000 11:115585371-115585393 AGTGGGAAGGCCAGTGAAGAAGG + Intergenic
1090725657 11:129524967-129524989 TTGTTGAAGGCCAATGATGAAGG + Intergenic
1093056201 12:14558243-14558265 ATTGTGAAGGCCTGCCATGATGG - Intronic
1093854828 12:24088870-24088892 ATTCAGAAGGCCAGTGAAGAAGG - Intergenic
1094422859 12:30290188-30290210 ATTGTAAAGACCATCGATGCTGG + Intergenic
1097917288 12:65034542-65034564 ATTGTAAAGACCATCGATGCTGG - Intergenic
1098935242 12:76471693-76471715 ATTGTGAAGAGCCTTGAAGATGG - Intronic
1100723405 12:97383061-97383083 ATTCTGCAGCCCATGGATGAAGG - Intergenic
1101120911 12:101579204-101579226 ATTGTTAAGGCCATGGATTCAGG + Intronic
1101243107 12:102857877-102857899 ATTGTAAAGACCATTGATTCCGG + Intronic
1101561138 12:105859221-105859243 ACTGTGAGGGCCATTGACCAAGG + Intergenic
1103150226 12:118631702-118631724 ATTCAGAAGGCCTTTGAGGAGGG - Intergenic
1103265898 12:119629815-119629837 GATGAGAAGGCCAATGATGATGG - Exonic
1104046699 12:125168265-125168287 AGTGTGAAGGACATGGATCAGGG + Intergenic
1104498893 12:129266092-129266114 CTTGTGAAGGCCACTGATGATGG + Intronic
1104586792 12:130054028-130054050 AGTGTGATGGCCAGGGATGAAGG - Intergenic
1106497591 13:30295099-30295121 ATTCTGCAGGCCATGGATAAAGG + Intronic
1106657539 13:31762323-31762345 ACTTTGAAGTCCATGGATGAAGG + Intronic
1107370539 13:39742156-39742178 ACTGTAAAGACCATTGATGCTGG + Intronic
1108061770 13:46540259-46540281 ATTGTGAAAGACTTTGAAGAGGG + Intergenic
1108988969 13:56630750-56630772 ATTGTAAAGACCATTGATGCTGG + Intergenic
1109126003 13:58517727-58517749 CTAGTTAAGGTCATTGATGAAGG + Intergenic
1112764627 13:102727734-102727756 ATTGTGCTGGCCATGCATGATGG + Intergenic
1112942267 13:104878020-104878042 GATGTGGTGGCCATTGATGAAGG + Intergenic
1113486902 13:110660512-110660534 ATTCTGCAGCCCATTGATCAAGG - Intronic
1115197884 14:30821507-30821529 ATCGTGAAGAACATTGATGATGG + Intergenic
1115258860 14:31432266-31432288 ATTCTGCAGGCCATGGATCAAGG + Intronic
1117170239 14:53086704-53086726 ATTGTAAAGACCATTGATGCTGG + Intronic
1117369758 14:55066706-55066728 ATTATGAAGTCCATTGATTTTGG + Exonic
1119473481 14:74913254-74913276 ATTCTGAAAGCCCTTGGTGAGGG + Intronic
1120206750 14:81595607-81595629 ATAGTGGAGGCCATTCTTGATGG - Intergenic
1120598553 14:86472053-86472075 ATTGTAAAGACCATTGAGGCTGG - Intergenic
1123845934 15:24301963-24301985 AGTTTGAAGGCCATAGATCATGG + Intergenic
1124036624 15:26059056-26059078 ATTCTGAAGCCCATAGGTGAAGG + Intergenic
1124859261 15:33422477-33422499 ATTGTGATTGCCATTGCAGAGGG + Intronic
1125465397 15:39946076-39946098 ATTCTGTAGCCCATGGATGAAGG + Intronic
1125490622 15:40146044-40146066 ATTCTGATGGCAATTGCTGAAGG + Intergenic
1126777852 15:52114487-52114509 ACTGTGAAGGGCAGTGGTGAAGG + Intergenic
1127783179 15:62333453-62333475 ATTTTGAAGGCCATTGTATATGG - Intergenic
1128478622 15:68018515-68018537 ATTATCAAGCCCATTGAGGAGGG + Intergenic
1128692177 15:69733071-69733093 ATAGTCAAGGCCAGAGATGAAGG - Intergenic
1134303165 16:13009336-13009358 ATTGGGAAGGACATTCAGGAAGG + Intronic
1135502484 16:23008724-23008746 ATTGGGAATTCCATTGGTGATGG + Intergenic
1141877511 16:86836097-86836119 GATGGGAAGGCCACTGATGAGGG - Intergenic
1142314347 16:89334250-89334272 ATTGTGAAGGCCATTGATGAGGG - Intronic
1144530710 17:16036130-16036152 ATTCTGAAGCCCATGGATCAAGG - Intronic
1150094308 17:62359002-62359024 ATTGTAAAGACCATCGATGATGG + Intergenic
1150518631 17:65842473-65842495 ACTGTGAAAGCCATTGAGAAGGG + Intronic
1151001237 17:70379386-70379408 ATGGTGAAGGTCATTGAGGATGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153871845 18:9328747-9328769 ATTCTGAAGCCCATGGATCAAGG + Intergenic
1154370551 18:13757905-13757927 ATTCTGCAGCCCATTGATCAAGG - Intronic
1156468146 18:37361103-37361125 CTTGTGAAGGCCATTCATACAGG + Intronic
1156992940 18:43431928-43431950 CTTGTGAAGGCCATGGTTGTTGG - Intergenic
1157020193 18:43772191-43772213 GTTGTTAAAGCCATTCATGAAGG - Intergenic
1157631883 18:49106494-49106516 ATTGTAAAGACCATTGAGGCTGG - Intronic
1158176955 18:54668268-54668290 ATTGTAAAGACCATTGAGGCTGG - Intergenic
1158187208 18:54784249-54784271 AAGGTGAAGGCCAGTTATGATGG - Intronic
1158658470 18:59362385-59362407 ATTATGTGTGCCATTGATGAGGG - Intergenic
1166006928 19:39914472-39914494 GTTTTGAAGGCCATGGGTGAGGG - Intronic
928741171 2:34354367-34354389 ATGGTGAGAGGCATTGATGATGG + Intergenic
929093966 2:38246599-38246621 AATGAGAAGCCCATCGATGATGG + Intergenic
929149890 2:38738086-38738108 ATTGTTACTTCCATTGATGATGG - Intronic
929939099 2:46317367-46317389 ATTCTGAAGCCCATGGATCAAGG - Intronic
931572582 2:63684378-63684400 ATCATGAAGAACATTGATGATGG + Intronic
932335766 2:70930610-70930632 TTTCTGAAGGCCTTTGCTGAAGG + Intronic
934625111 2:95841051-95841073 ATTCTGAAGCCCATGGATCAAGG + Intronic
934808454 2:97260219-97260241 ATTCTGAAGCCCATGGATCAAGG - Intronic
934829055 2:97496967-97496989 ATTCTGAAGCCCATGGATCAAGG + Intronic
935844875 2:107155021-107155043 ATTGTGCCAGCTATTGATGATGG + Intergenic
937180690 2:119993516-119993538 ATTGTGAAGAACATTGATGATGG - Intergenic
939873986 2:147555735-147555757 TTTGAGAAGCCCATTGATTATGG + Intergenic
942480670 2:176384944-176384966 AGTGTGTAGGCCTTTGATAATGG - Intergenic
942489827 2:176477970-176477992 ATGGTAAAGGCCATTTATCAGGG - Intergenic
943523663 2:188988845-188988867 ATTTTGATGGCTAATGATGAGGG - Intronic
946786875 2:223256572-223256594 ATTGTGGAGGCTATTAATTATGG + Intergenic
947035406 2:225848168-225848190 ATTCTGAAGCCCATGGATCAAGG - Intergenic
947197170 2:227579963-227579985 ATTTACAAGGCCAGTGATGATGG - Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
1168832177 20:852117-852139 TCTGTGGAGGCCATTTATGAAGG + Intronic
1170714603 20:18820792-18820814 ATTGAGCAGGTCATTGTTGAGGG + Intronic
1172230009 20:33330239-33330261 ATTGTGAAGGTCATTTGTGTAGG - Intergenic
1174652660 20:52141210-52141232 ATTCTGTAGCCCATGGATGAGGG + Intronic
1176049674 20:63111349-63111371 TTTGTGAAGGCCACTGAGGATGG - Intergenic
1176788700 21:13292461-13292483 ATTTTGGGGGCCATTCATGAAGG - Intergenic
1177167481 21:17618880-17618902 ATTGTGCAGCCCATGGATCAAGG - Intergenic
1177987861 21:28000607-28000629 ATTTTGGGGGCCATTTATGAAGG - Intergenic
1178167082 21:29991671-29991693 CTTCTGAAGGCCATTGAAAAGGG + Intergenic
1178967566 21:37136706-37136728 CTAGTGAAGATCATTGATGAAGG + Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1182589800 22:31370336-31370358 ATTATGAAGTCCATTGATGGTGG + Intergenic
1183611489 22:38910071-38910093 ATTGTCAAGGCCATGCATGGTGG + Intergenic
1185178144 22:49342545-49342567 ATTCTGCAGCCCATAGATGAAGG + Intergenic
949736732 3:7181197-7181219 ATTATGAAGGCCATTGGGTATGG - Intronic
951517615 3:23579048-23579070 ATTCTGAAGGCCATGTATCAAGG + Intronic
952593883 3:34990508-34990530 ATTCTGCAGCCCATTGATCAAGG + Intergenic
952628588 3:35438163-35438185 ATTGTGAAGGCCCTAGCTAAGGG + Intergenic
952628632 3:35438487-35438509 ATTGTGAAGGCCCTAGCTAAGGG - Intergenic
955389605 3:58511383-58511405 ATCATGAAGGACATTGATGATGG + Intronic
957778717 3:84790287-84790309 ATTCTGAAACACATTGATGATGG + Intergenic
958060891 3:88478484-88478506 ATTGGCAAGGCATTTGATGAGGG - Intergenic
959090710 3:101899907-101899929 ATTCTGGAGGCCCTTGAAGAAGG - Intergenic
959300507 3:104593759-104593781 ACTGTTAAGGTCATTGATAAGGG - Intergenic
959877480 3:111402042-111402064 ATTGTAAAGGCCAAGGAAGAAGG - Intronic
960184465 3:114621782-114621804 ATTGTGAAGGCTTATGATCAAGG + Intronic
960374784 3:116886200-116886222 ATAATGAAGGCCAATGAAGAGGG - Intronic
963236935 3:142964604-142964626 ATCATGGAGGGCATTGATGAGGG + Intronic
963905595 3:150771235-150771257 CTTGTGTAGGCCCTTGGTGAAGG - Intergenic
964018995 3:151984260-151984282 ATTCTGAAGTCCATGGATCAAGG - Intergenic
964676323 3:159285098-159285120 ATTGTAAAGGCCATCTTTGATGG - Intronic
965462899 3:168990763-168990785 CTTGTGAAGGACTTTGTTGAAGG + Intergenic
967246515 3:187492146-187492168 ATTGTGAAGGGCCTTGGAGAAGG + Intergenic
967492296 3:190107464-190107486 TTTGTGAAAGTCATTTATGAGGG - Intronic
967828441 3:193897766-193897788 GTTGTGAAGGCCAAAGAGGATGG + Intergenic
968445930 4:652036-652058 AGTGTGGAGGCCAGTGAGGAGGG + Intronic
970263313 4:14252802-14252824 GTGGTGCAGGCCATTCATGAAGG - Intergenic
971081623 4:23219117-23219139 ATTATGAAAGTCATTGATAATGG + Intergenic
972685811 4:41351500-41351522 ATTGTAAAGACCATTGATGCTGG + Intergenic
972998699 4:44917800-44917822 AATCTGAAGACCATTGATAAAGG - Intergenic
974574231 4:63697368-63697390 ATTGTGAACCACTTTGATGAAGG + Intergenic
976119108 4:81760662-81760684 ATTTTGAACTCCTTTGATGAAGG - Intronic
976736919 4:88319546-88319568 ATTTTGAAGGACATTGTTGAAGG + Intergenic
977069870 4:92371718-92371740 ATTTTGCAGCCCATAGATGAAGG + Intronic
977688205 4:99873515-99873537 ATTCTGCAGCCCATAGATGAGGG - Intergenic
978287112 4:107092511-107092533 ATTCTGAAGGCCATGGATCAAGG + Intronic
978523333 4:109639225-109639247 ATTTTGAAGCCCATGGATCAAGG - Intronic
978610877 4:110537793-110537815 ATTCTGAAGCCCATGGATCAAGG - Intronic
979203866 4:118011155-118011177 ATTGTGAACCCCAGTGTTGAAGG - Intergenic
979345588 4:119583161-119583183 CTAGTGAAGATCATTGATGAAGG - Intronic
979931149 4:126632238-126632260 ATTGTGAAGCCCATTGTTGGTGG - Intergenic
981934223 4:150221730-150221752 ATTGGAAAGGTCATTGGTGATGG + Exonic
983258733 4:165432213-165432235 ATTGTGCCGGGCACTGATGACGG + Intronic
983275972 4:165617924-165617946 CTAGTGAAGCTCATTGATGAAGG + Intergenic
985799874 5:1998283-1998305 ATGGTGAAGGTCATGGATGATGG + Intergenic
986973797 5:13371300-13371322 ATTATGAAGGGCAGTGAAGAGGG + Intergenic
988048303 5:25989212-25989234 ATTGTGAAGCCCATGAATCAAGG + Intergenic
988330489 5:29832539-29832561 ATTGCTAAGATCATTGATGAAGG - Intergenic
988431734 5:31126923-31126945 ATTCTGCAGGCCATGGATCAAGG + Intergenic
988554169 5:32222004-32222026 ATTGTGAAGAACAATGATGATGG + Intergenic
988590813 5:32547524-32547546 ATTCTGTAGGCCATGGATCAAGG + Intronic
989165501 5:38430068-38430090 ATCGTGAAGAACATTGATGATGG - Intronic
992866967 5:80967512-80967534 ATTGTGAAGACCTGTGGTGATGG + Intronic
993214308 5:84999874-84999896 ATTGTGAAGGCCATAGGCTATGG - Intergenic
994131147 5:96229369-96229391 ATTCTGAAAGGCATTGTTGATGG - Intergenic
995849316 5:116528387-116528409 ATTGTAAAGGCGAATGAGGATGG - Intronic
996091808 5:119358844-119358866 ATTGAGAAAGCCATTGTTAAGGG + Intronic
996315613 5:122157538-122157560 GGTGTGAAGCCCATTCATGAAGG + Intronic
996319499 5:122198618-122198640 ATTTTGAAGTCCATTTAGGATGG + Intergenic
996769113 5:127066952-127066974 ATTGTCAAGGAGACTGATGAGGG + Intronic
996788796 5:127270135-127270157 ATTGTAAAGACCATCGATGCTGG + Intergenic
997861484 5:137421886-137421908 ATTGTAAAGACCATTGAGGCTGG - Intronic
998281074 5:140808142-140808164 ATTGTAGAGGGCATTGATAAGGG + Exonic
999524575 5:152390318-152390340 ATTCTGAAGCCCATAGATCAAGG - Intergenic
1002658795 5:180775823-180775845 ATGGAGAATGCCATTGATGCTGG - Intergenic
1005176130 6:23046837-23046859 AGTGTGAAGGTCATTGTTGCAGG + Intergenic
1006027103 6:31154169-31154191 ATTGTGGAGGGCAGTGAGGAAGG - Intronic
1008112488 6:47507788-47507810 ATTTTGCAGCCCATTGATCAAGG - Intronic
1008185780 6:48388800-48388822 ATTGTGAAGGGCCTTAAAGAGGG - Intergenic
1008514957 6:52309939-52309961 ATGGTCAAGGCCATTTATAATGG + Intergenic
1011096037 6:83664220-83664242 ATTGTGCAGCCCATGGATCAAGG + Intronic
1012930865 6:105314899-105314921 ATTCTGCAGCCCATGGATGAAGG - Intronic
1013311752 6:108901051-108901073 ATTGTGAAGGCCTTTCTTGTAGG + Intronic
1015304304 6:131689645-131689667 ATTCTGCAGGCCATGGATCAAGG + Intronic
1015511486 6:134042290-134042312 ATTGTGAAGGCTGTGGATGAAGG + Intronic
1016504950 6:144768808-144768830 ATTGTGAAGGTCTTTGTTGTGGG - Intronic
1017847597 6:158273004-158273026 AAAGTGAAGGCCCTTGTTGAGGG + Intronic
1019866539 7:3716511-3716533 ACTTTGAGGGACATTGATGAGGG + Intronic
1020091135 7:5341991-5342013 ATTCTGCAGCCCATAGATGAAGG + Intronic
1020664638 7:11024839-11024861 ATTCTGAAGCCCATGGATCAAGG + Intronic
1021301568 7:18979850-18979872 ATGGTGCAAGCCATTCATGAGGG + Intronic
1022685389 7:32591505-32591527 ACTGTGAAGGCCAGTGAGGAAGG - Intergenic
1023476963 7:40591026-40591048 ATTGTGCAGCCCATGGATCAAGG + Intronic
1023480590 7:40629559-40629581 ATTTTGAAGGCCATTATAGAGGG + Intronic
1024738147 7:52327905-52327927 ATTGTAAAGGCCATCGATGCAGG - Intergenic
1024837955 7:53546277-53546299 ATTCTGCAGCCCATTGATTAAGG + Intergenic
1028349551 7:89828585-89828607 ATTCTGCAGCCCATTGATAAAGG + Intergenic
1028352840 7:89870354-89870376 ATTCTGCAGCCCATGGATGAAGG - Intergenic
1031439805 7:121779820-121779842 GTTGTGGACCCCATTGATGAAGG - Intergenic
1031860170 7:126970335-126970357 TTAGTGAAGAGCATTGATGAAGG - Intronic
1032359559 7:131242664-131242686 ATCGTGAAGAACATTGATGATGG + Intronic
1032964330 7:137078619-137078641 AGAGTGAAGGCAATTGATGGGGG - Intergenic
1035828270 8:2668092-2668114 ATTTTGAAGGCCAGTGATAAAGG + Intergenic
1037006596 8:13788980-13789002 ATTGTGCAGTCCATCGATAAAGG - Intergenic
1037281951 8:17251145-17251167 ATTGTTTATGCCAGTGATGATGG + Intronic
1037604554 8:20426183-20426205 ATGGTGGATGCCATTGATGCCGG + Intergenic
1040732324 8:50463426-50463448 ATTCTGAAGCCCATGGATCAAGG - Intronic
1041366872 8:57115640-57115662 AGTGTGAAGGTCATCAATGATGG - Intergenic
1041876405 8:62692256-62692278 ATTGTAAAGGGCATAGATAAGGG + Intronic
1042789929 8:72593765-72593787 ATTGTTAAGGCCATTTTTTATGG + Intronic
1043523590 8:81072787-81072809 ATTGGAAAGGGCATAGATGAGGG + Intronic
1043710843 8:83416634-83416656 ATTGTGAAAGACATTGCTAAGGG - Intergenic
1044259479 8:90100939-90100961 ATTCTGTAGCCCATGGATGAAGG - Intergenic
1045055847 8:98367767-98367789 AATGGGAAGCACATTGATGAAGG + Intergenic
1045104051 8:98873931-98873953 ATTGTAAAGACCATTGATACTGG - Intronic
1045952193 8:107865044-107865066 ATTGTGAAGGGCCTTGGAGAAGG - Intergenic
1046139443 8:110071139-110071161 ATTGTGAAGGGTCTTGAAGATGG - Intergenic
1046845246 8:118908076-118908098 ATTGTTAAGGCCACTGTTCATGG + Intergenic
1047120754 8:121901893-121901915 ATTCTGAAGGCCTTCGATCAAGG + Intergenic
1048713644 8:137242420-137242442 ATTGTAAAGACCATCGATGCTGG + Intergenic
1048796572 8:138155348-138155370 ATTGTAAAGACCATCGATGCTGG + Intronic
1050699979 9:8328106-8328128 ATTGTAAAGACCATCGATGCTGG - Intronic
1050774378 9:9241933-9241955 ATTGTAAAGACCATCGATGCTGG - Intronic
1051433649 9:17007101-17007123 ATTTTGAAGGCGTTTGATCAAGG + Intergenic
1051568371 9:18526527-18526549 ATTGTAAAGACCATTGATGCTGG - Intronic
1051594111 9:18806861-18806883 GATGTGAAGGCCATTAAGGAAGG - Intronic
1051919103 9:22243265-22243287 ATTCTGAGGGCCTTTGAGGATGG + Intergenic
1053250483 9:36570335-36570357 ATTCTGTAGGCCATAGATCAAGG + Intergenic
1054723803 9:68630091-68630113 CTTTTGGAAGCCATTGATGAGGG - Intergenic
1055415983 9:76083662-76083684 ATTGAAAAGGCATTTGATGATGG - Intronic
1056093707 9:83229709-83229731 ATTCTGTAGCCCATTGATTAAGG - Intergenic
1056191512 9:84188768-84188790 ATTCTGCAGCCCATTGATTAAGG + Intergenic
1058690207 9:107513803-107513825 CTTGTGAAGGCCTTTAATTAAGG + Intergenic
1059092910 9:111380164-111380186 ATTCTGAAGCCCATGGATCAAGG - Intronic
1059125682 9:111682639-111682661 AAGGGGAAGGCCATTGTTGAGGG + Intergenic
1059904040 9:118961906-118961928 ATTCTGTAGGACATTGATTATGG - Intergenic
1061841396 9:133360363-133360385 AGAGAGAAGGCCACTGATGAGGG + Exonic
1186160126 X:6768536-6768558 ACTGTGGAGGCTATTGATGTTGG + Intergenic
1194094303 X:89618632-89618654 ATTGTAAAGACCATTGATGCTGG - Intergenic
1194095630 X:89635903-89635925 ATTGAAAAAGGCATTGATGAGGG + Intergenic
1195517162 X:105790245-105790267 ATTGTAAAGTCTATTGATTAGGG + Intergenic
1196175299 X:112633554-112633576 ATTGTGAGAGCCTCTGATGAGGG - Intronic
1196332443 X:114488088-114488110 ATTGTGAAGTCCATTCATAATGG - Intergenic
1197643674 X:128993915-128993937 ATCTTGAAGCCCATTGATAAGGG + Intergenic
1199409412 X:147503142-147503164 ACAGTTAAGGCAATTGATGAGGG + Intergenic
1200109722 X:153734119-153734141 AGAGTCAAGGCCATTGATGAGGG + Intronic
1200446937 Y:3274812-3274834 ATTGTAAAGACCACTGATGCTGG - Intergenic
1200448629 Y:3297271-3297293 ATTGAAAAAGGCATTGATGAGGG + Intergenic
1200518188 Y:4175523-4175545 ATTGTGAAGAACATGGATGGTGG - Intergenic
1200771875 Y:7133881-7133903 ATGGTAAAGACCATTGATGCTGG - Intergenic
1200847163 Y:7842495-7842517 ATTGTAAAGACCATTGATGCTGG - Intergenic
1202020619 Y:20461362-20461384 ATTGTAAAGACCATTGATGCTGG - Intergenic