ID: 1142319886

View in Genome Browser
Species Human (GRCh38)
Location 16:89374523-89374545
Sequence CAGCGGCCGGCAGAGGCCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142319886_1142319890 12 Left 1142319886 16:89374523-89374545 CCGATGGCCTCTGCCGGCCGCTG 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1142319890 16:89374558-89374580 ACACTCTGTCCTATGCTTCCAGG 0: 1
1: 0
2: 1
3: 17
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142319886 Original CRISPR CAGCGGCCGGCAGAGGCCAT CGG (reversed) Intronic
900147291 1:1163820-1163842 CAGAGGCCGGCCGAGCCCATGGG + Intergenic
900655661 1:3755579-3755601 CAGGTGCAGGCAGAGGCCCTAGG - Intronic
903040724 1:20528111-20528133 CAGGGGCAGGAAGAGGCAATAGG + Intergenic
903645511 1:24893546-24893568 GAGCAGCTGGCAGAGGCCAGGGG - Intergenic
905869186 1:41393443-41393465 CAGCGACCGGCAGAGGGCAAGGG - Intergenic
907309991 1:53533730-53533752 CAGCTGCAGGCAGATCCCATAGG - Intronic
907533484 1:55126226-55126248 CTGGTGCCGGCAGAGGCCACAGG - Intronic
907637776 1:56153465-56153487 CAGTGGGCAGCAGAGGGCATGGG + Intergenic
908164469 1:61444460-61444482 CAGAGGCCGGCAGAGTTCAGAGG + Intronic
910759433 1:90719746-90719768 CAGGGGCCGACAGTGGCCAGAGG + Intergenic
912392560 1:109314334-109314356 CAGCAGCATGCAGAGGCCAATGG - Exonic
915313439 1:155015832-155015854 AAGGGCCCGGCAGGGGCCATGGG + Intronic
918310080 1:183279530-183279552 CAGCTGCCAGCACAGGCCCTGGG + Intronic
922503002 1:226110490-226110512 AAGCGGCCAGCCGAGGCCAGTGG - Intergenic
1063010753 10:2019906-2019928 CAGCGGCCCTCAGAGGGCACAGG - Intergenic
1063298062 10:4826307-4826329 GGGCGGCCGGCGGCGGCCATGGG + Exonic
1067721677 10:48732120-48732142 CAGGGGACAGCAGAGGCTATTGG - Intronic
1070552512 10:77501777-77501799 CAGGGGCAGGCAGAGGCCTTGGG + Intronic
1075455569 10:122582723-122582745 CAGCTGCCGGCAGACCACATTGG - Exonic
1075457692 10:122595426-122595448 CAGCTGCCGGCAGACCACATTGG - Exonic
1076916838 10:133427227-133427249 CTGCAGCTGGCAGAGGCCACAGG + Intergenic
1076936941 10:133572027-133572049 CTGCAGCTGGCAGAGGCCACAGG + Intergenic
1077036934 11:499789-499811 CAGCGGCCAGCATGGGCCCTGGG + Intronic
1077091102 11:778627-778649 CCGCGCCCGGCGGAGGCCAGTGG - Intronic
1078100749 11:8329014-8329036 CGGAGGCCCGGAGAGGCCATTGG - Intergenic
1083266741 11:61550420-61550442 CAGCAGCGGGCAGGGGCCAGAGG + Intronic
1083685268 11:64371541-64371563 CAGCCGCAGGCAGAGGCCTCCGG - Exonic
1083691079 11:64409374-64409396 GAGTGGCCGGCAGAGACCCTGGG - Intergenic
1083766477 11:64843791-64843813 CAGCAGCCTGCACAGGCCAAGGG + Intronic
1084043329 11:66555231-66555253 CAGCTGCAGGCAGAGGCCTTGGG - Intronic
1084403957 11:68960422-68960444 CAGCAGCTGTCCGAGGCCATGGG + Intergenic
1085470226 11:76752919-76752941 CAGGGGCAGGGAGAGGCCTTGGG + Intergenic
1089432397 11:118435518-118435540 CAGCGGCAGGCAGAGACCGGAGG + Intergenic
1089580992 11:119481941-119481963 CAGCAGCCAGGAGAGGCCCTCGG + Intergenic
1089588391 11:119524296-119524318 CAGAGGCGGACAGAAGCCATGGG + Intergenic
1089729411 11:120511389-120511411 CGGCGCCCGGCAGAGGCTAGGGG - Intergenic
1090007000 11:123011595-123011617 CAGAGGCTGGCAGAGGCCACTGG + Intergenic
1090807702 11:130212697-130212719 CAGCAGCTGGGAGAGGCCAGAGG + Intergenic
1091714717 12:2768690-2768712 CAGGGGGAGGCAGAGGACATAGG - Intergenic
1092118957 12:6030430-6030452 GAGCTGCAGGCTGAGGCCATGGG + Intronic
1095954161 12:47797019-47797041 CGGCGGCCCGCAGAGACCCTCGG - Exonic
1096539234 12:52295530-52295552 CAGGGCCCTGCAGAGGGCATGGG - Intronic
1096775639 12:53961822-53961844 CAGCGGGCGGCACAGGTCTTAGG - Intergenic
1102550996 12:113692171-113692193 CAGCCGGCGGTTGAGGCCATGGG - Intergenic
1103940792 12:124500229-124500251 CAGGGGCCAGCAGGGGCCCTGGG - Intronic
1105824554 13:24110464-24110486 CAGCAGCCGGCAGAGTCAAGGGG - Intronic
1108532565 13:51341311-51341333 CAGCAGCTGGCAGATGCCCTGGG + Exonic
1109780649 13:67106788-67106810 CAGGGGCAGGGAGAGGCCAGGGG - Intronic
1112577343 13:100647283-100647305 GAGTGGCCGGCAGGGGCCAGGGG - Intronic
1113411089 13:110090587-110090609 CAGCAGCAGGCAGTGGCCAAGGG + Intergenic
1114083448 14:19220304-19220326 CTGCGGCAGGCAGTGGCCAGTGG + Intergenic
1115763616 14:36600500-36600522 GAGCTGCTGGGAGAGGCCATGGG + Intergenic
1119426054 14:74535384-74535406 CTGGGGCTGGCAGAGGCCAGTGG - Intronic
1121313123 14:92945840-92945862 CAGCGCCGGGCAGAGGCCTGGGG - Intronic
1122918737 14:104870935-104870957 CAGAGGCCGGCAGGGGGCAGCGG - Intronic
1122985896 14:105211502-105211524 CAGGGGCTGGCAGAGGCCTGAGG - Intronic
1124616903 15:31248623-31248645 CAGAGGCCCTCAGAGGCCATTGG + Intergenic
1126437868 15:48654264-48654286 CAGAGTATGGCAGAGGCCATGGG + Intergenic
1127291295 15:57573775-57573797 CAGAGGCCCACAGAGGCCTTAGG + Intergenic
1128263894 15:66252186-66252208 CGGCGGCCGGCTGGGGCAATCGG - Intronic
1128307772 15:66611371-66611393 CAGTGGCCGGCAGAGTCAAAGGG - Intronic
1134815185 16:17199886-17199908 GAGAGGCAGGCAGAGGGCATTGG + Intronic
1140797754 16:78455954-78455976 CATAGGCCGGCAGTGGCTATAGG + Intronic
1142319886 16:89374523-89374545 CAGCGGCCGGCAGAGGCCATCGG - Intronic
1142631429 17:1228969-1228991 CAGCGGGAGGCCGAGGCCAAGGG - Intronic
1142643481 17:1298288-1298310 CAGAGGCCGGCCCTGGCCATCGG + Exonic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG + Intergenic
1145016675 17:19403256-19403278 CAGCAGCACCCAGAGGCCATTGG + Intergenic
1146575014 17:33983584-33983606 TGGCAGCAGGCAGAGGCCATAGG - Intronic
1150388682 17:64778948-64778970 CAGCGGCCGGTAGCGCTCATTGG + Intergenic
1151335654 17:73438148-73438170 CAGGGGCCTGCAGAGGGCAAGGG + Exonic
1151946734 17:77323717-77323739 CAGGGGATGGCAGAGGCCATCGG - Intronic
1151947863 17:77329337-77329359 CAGCATCCAGCAGAGGCCACTGG + Intronic
1152074251 17:78148989-78149011 CAGCTGCTGGCAGATGGCATGGG + Intronic
1154500132 18:14991967-14991989 CTGCGGCAGGCAGTGGCCAGTGG + Intergenic
1155657737 18:28210867-28210889 CAGCGGCCGGAAGGAGCCCTGGG + Intergenic
1158073736 18:53504301-53504323 CAGCCACAGGCAGAGGTCATGGG + Intronic
1159426800 18:68299431-68299453 CAGCTCCCGGCAGAGGACGTGGG + Intergenic
1159599957 18:70419486-70419508 CTGCGGCCGGCAGAGCCCGCGGG + Intergenic
1160763923 19:798702-798724 CAGTGGCCGGGAGAAGCCGTGGG + Intronic
1161003786 19:1924500-1924522 CTGTGGACGGCAGAGGCCAAGGG - Exonic
1161515428 19:4693656-4693678 CAGGGGCCGGGAGAGGCGACAGG - Intronic
1162361818 19:10224915-10224937 CAGAGGCCTGCTGGGGCCATGGG + Exonic
1163688394 19:18725231-18725253 CAGAGGCCTGCAGAGGTCAGAGG - Intronic
1164678342 19:30117975-30117997 CACGGGACAGCAGAGGCCATGGG - Intergenic
1166046417 19:40233320-40233342 CAGGGGCAGGCAGGGGCCCTTGG - Exonic
1166090579 19:40506153-40506175 CAGGGGCTGGCATAGGCAATGGG + Intronic
1166395105 19:42433837-42433859 CAGGGGTCGCCAGAGGCCACAGG - Exonic
1166749712 19:45159051-45159073 CAGCGGCCCTCCGAGCCCATGGG - Exonic
1167592697 19:50413134-50413156 CTGCGGCCTGAAGAGGCCACTGG - Intronic
1168027687 19:53655023-53655045 CAGTGGACTGAAGAGGCCATGGG + Intergenic
1168161910 19:54516040-54516062 GAGTGACTGGCAGAGGCCATGGG - Intergenic
928413429 2:31071706-31071728 CAGAGGCAGGCAGGGGCCAGAGG - Intronic
930005326 2:46892052-46892074 CAGCGGCAGGCAGGAGGCATGGG - Intergenic
932786199 2:74606063-74606085 CAGAGGCCAGCAGAGGTCACTGG + Intronic
937682376 2:124657690-124657712 CAGGGGCTGGCAGAGGCCTGTGG - Intronic
938137913 2:128774447-128774469 CAGGTGCCTGCAGAGGCCCTGGG - Intergenic
944853865 2:203747492-203747514 CAGCGGCCTGTAGAGGAGATTGG + Intergenic
946500290 2:220240023-220240045 CAGAGCCCAGCAGAGGCCAGAGG - Intergenic
947793115 2:232878930-232878952 CAGAGGCTGGCAGAGGCCTGGGG + Exonic
948326581 2:237126656-237126678 CAGGGGCTGGCAGAGTCCCTGGG + Intergenic
948907709 2:240987694-240987716 CAGCACCCGACAGAGGGCATTGG + Intronic
1172269268 20:33644486-33644508 CAGCGGCCGGCCCTGGCCGTGGG - Exonic
1173162763 20:40664472-40664494 CAGCGGACTGCAGAGGTAATTGG - Intergenic
1174146551 20:48456211-48456233 CAGGGGCCCACAGAGGCCAAGGG - Intergenic
1174579037 20:51557962-51557984 CAGAGGCCAGCAGAGCCCAGAGG + Intronic
1174870287 20:54174823-54174845 CAGAGGCGGGCAGTGGACATAGG - Intergenic
1175108072 20:56628594-56628616 CCGCGGCTGGCTGAGGCCAGGGG - Intergenic
1175223870 20:57433625-57433647 CAGGGGCCTGCAGAGGCCCTGGG - Intergenic
1175304450 20:57966359-57966381 CAGCTGGCTGCAGAGCCCATGGG - Intergenic
1176179013 20:63740955-63740977 CAGCAGCCGGCAGCAGCCAGGGG - Intronic
1176710448 21:10145811-10145833 CTGCGGCAGGCAGTGGCCAGTGG - Intergenic
1179826516 21:43969061-43969083 CAGCGTCGGACAGAGGCCAGGGG - Intronic
1180294527 22:10872963-10872985 CTGCGGCAGGCAGTGGCCAGTGG - Intergenic
1180497333 22:15902377-15902399 CTGCGGCAGGCAGTGGCCAGTGG - Intergenic
1181058112 22:20269283-20269305 CAGGGGCAGGCAGAGGGCACAGG - Intronic
1181161999 22:20965017-20965039 CAGGGGCAGGCCGAGGCCCTCGG - Intergenic
1181260561 22:21594173-21594195 CAGCGGCAGGCACAGGGCAAGGG - Intronic
1183962158 22:41418075-41418097 CAGTGGCTGGCAGAGGGCACGGG - Intergenic
1184232138 22:43163847-43163869 CAGCTGCCTGGAGAGGCCATGGG - Intergenic
1184477710 22:44730347-44730369 CAGGGGACAGCAGAGGCCTTGGG + Intronic
1184790113 22:46694998-46695020 CAGCTGCCTGCGCAGGCCATGGG + Intronic
953338501 3:42113996-42114018 TAGCGGCTGGCAGAGGCTAAGGG - Intronic
954671270 3:52292512-52292534 CAGCGGCAGGCCGAGGCACTGGG + Exonic
955705138 3:61719940-61719962 GAGCGGCCAGCAAAGGCCTTAGG - Intronic
961555292 3:127692900-127692922 CAGCCGCCTGCAGAGGCCAGTGG - Intronic
961648092 3:128403337-128403359 CAGGGGCAAGCAGAGGCCAGAGG + Intronic
961851664 3:129825753-129825775 CAGCGGCTACCAGAGGCCACCGG + Intronic
964012171 3:151904259-151904281 TAGCCCCTGGCAGAGGCCATTGG - Intergenic
967228388 3:187314564-187314586 CAGCAGCTGGCAGAGCCCACGGG - Intergenic
968729310 4:2262158-2262180 CGGCGGCCCGCAGAGCCAATGGG + Exonic
969184450 4:5465039-5465061 CAGGGGAAGGGAGAGGCCATTGG + Intronic
969517931 4:7658839-7658861 CAGTGGTGGGGAGAGGCCATGGG + Intronic
978761630 4:112359646-112359668 CAGAGGCCAGCAGGGGCCTTGGG + Intronic
981475277 4:145180777-145180799 CATCGGCCGGCGGAGCCCCTCGG - Intergenic
984767514 4:183410722-183410744 CAGCTGCCTGCAGAGGCTTTGGG + Intergenic
984852776 4:184168590-184168612 CAGCCGCCAGCAGAGGGCAGTGG - Intronic
985471863 5:51592-51614 CAGAGGCGCGCAGGGGCCATGGG - Intergenic
985646036 5:1085158-1085180 GAGAGGCGGGCAGAGCCCATGGG + Intronic
996056437 5:118988246-118988268 CTGCAGCCGGCAGCGGCCTTCGG - Intronic
1001933838 5:175691049-175691071 CCAGGGCCTGCAGAGGCCATGGG - Intergenic
1006727482 6:36210429-36210451 CGGCGGCAGGCAGAGAACATCGG + Exonic
1007721428 6:43887615-43887637 CAGCTGCAGGCTGAGGCCATGGG - Intergenic
1015875239 6:137816058-137816080 CAGTGGCCAGGAGAAGCCATGGG - Intergenic
1017753577 6:157510842-157510864 CTGAGGAAGGCAGAGGCCATTGG - Intronic
1019669947 7:2272074-2272096 CAGCGGCTAGCAGAGGGCACTGG + Intronic
1020009138 7:4799014-4799036 CGGTGGCAGGCAGAGGCCATGGG + Intronic
1024526037 7:50350123-50350145 CAGCGGACGGTGGTGGCCATGGG - Intronic
1031972744 7:128075918-128075940 CTGCAGCAGGCAGAGGACATGGG - Intronic
1033303979 7:140210831-140210853 CAGAGGCCAGGAGAGGGCATGGG + Intergenic
1034224826 7:149474350-149474372 GTGCGGCCGGCAGGGGCTATGGG + Exonic
1034267719 7:149789315-149789337 CGGCGGCAGGCAGCGTCCATCGG - Intergenic
1035027753 7:155836890-155836912 GAGGGGCCGGCAGCGGCCAGGGG + Intergenic
1035206746 7:157298594-157298616 CAGCGCCCCCCAGAGGCCAGAGG + Intergenic
1036794203 8:11743529-11743551 CAGCGGCCAGCAGTGCCCAGGGG + Intronic
1037321403 8:17646739-17646761 CAGAGGCAGCCAGAGGCCGTGGG + Intronic
1037912435 8:22751799-22751821 CAGCAACAGGCAGAGGCCAAGGG - Intronic
1038846128 8:31231078-31231100 CACCGGCTGGAAGAGGCAATGGG + Intergenic
1042938914 8:74088288-74088310 CAGGGGCCAGCAGAGGGCAGTGG + Intergenic
1046556516 8:115779782-115779804 CATTGGCTTGCAGAGGCCATAGG - Intronic
1049070778 8:140353942-140353964 CAGCGGCAGGCACAGGGCACGGG + Intronic
1049419861 8:142511683-142511705 CAGCCGCTGGCAGGGGCCCTGGG + Intronic
1049624213 8:143612856-143612878 CATCGGCTGGCAGAGCCCAGCGG - Exonic
1049707467 8:144049528-144049550 CAGCGACCGGCCGAGGCCATTGG + Intergenic
1049759780 8:144326734-144326756 CGGCGGCCGGCAGGGGGCAGTGG - Exonic
1051844623 9:21437878-21437900 CAGAGGCCGGGAGAGGCGACTGG + Intronic
1053146366 9:35714785-35714807 TGGGGGCCGGCAGAGGCCTTGGG + Exonic
1059021773 9:110583439-110583461 CAGCGGCAGGCAGTGGAGATAGG + Intergenic
1061123528 9:128659107-128659129 CAGGTGGAGGCAGAGGCCATGGG - Intergenic
1061246589 9:129403886-129403908 CAGCTGCAGGGAGAGGCCCTTGG - Intergenic
1062165235 9:135104353-135104375 AGGCAGCCGGCAGAGGCCAGAGG - Intronic
1062617621 9:137405127-137405149 CACCCGCTGGCAGAGGCCCTGGG - Intronic
1202795212 9_KI270719v1_random:114806-114828 CTGCGGCAGGCAGTGGCCAGTGG - Intergenic
1188430572 X:30102215-30102237 CAAGGGCCAGCAGAGGCCAGTGG - Intergenic
1189988433 X:46573835-46573857 GAGGGGCCGGGAGAGGCCACAGG + Exonic
1200116015 X:153770028-153770050 GAGGGGGCAGCAGAGGCCATGGG - Intronic
1200128904 X:153830620-153830642 CAGGGGCCGTCAGGGGCCGTGGG + Intergenic
1200141646 X:153905572-153905594 CAGCAGCCAGGAGAGGCCACTGG + Exonic