ID: 1142321322

View in Genome Browser
Species Human (GRCh38)
Location 16:89384833-89384855
Sequence GTGTGTAAGAACATGTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 8, 3: 64, 4: 514}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142321319_1142321322 10 Left 1142321319 16:89384800-89384822 CCAACAACAGAACCGCTGCAGGT 0: 1
1: 0
2: 1
3: 5
4: 90
Right 1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG 0: 1
1: 0
2: 8
3: 64
4: 514
1142321317_1142321322 11 Left 1142321317 16:89384799-89384821 CCCAACAACAGAACCGCTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG 0: 1
1: 0
2: 8
3: 64
4: 514
1142321316_1142321322 22 Left 1142321316 16:89384788-89384810 CCACTAGACAGCCCAACAACAGA 0: 1
1: 0
2: 1
3: 26
4: 171
Right 1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG 0: 1
1: 0
2: 8
3: 64
4: 514
1142321320_1142321322 -2 Left 1142321320 16:89384812-89384834 CCGCTGCAGGTGAGAACATACGT 0: 1
1: 0
2: 1
3: 3
4: 77
Right 1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG 0: 1
1: 0
2: 8
3: 64
4: 514
1142321315_1142321322 23 Left 1142321315 16:89384787-89384809 CCCACTAGACAGCCCAACAACAG 0: 1
1: 0
2: 1
3: 10
4: 89
Right 1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG 0: 1
1: 0
2: 8
3: 64
4: 514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142321322 Original CRISPR GTGTGTAAGAACATGTGTGT GGG Intronic
900293776 1:1938304-1938326 GTGTGTGAGTGCATGTATGTGGG - Intronic
900566768 1:3336428-3336450 GTTTGCATGCACATGTGTGTTGG + Intronic
900580936 1:3408608-3408630 GTGTGTGAGTGCATGAGTGTGGG + Intronic
900754946 1:4427013-4427035 GTGACTAAGAATGTGTGTGTGGG + Intergenic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
902538344 1:17134849-17134871 GTGTGTGTGCACAGGTGTGTGGG - Intergenic
902538368 1:17135051-17135073 GTGTGTATGTGCATGTGGGTGGG - Intergenic
903275939 1:22221902-22221924 CTGTGTGAGAATATGTGTGCAGG - Intergenic
904687742 1:32273094-32273116 GTGTGCATGAATGTGTGTGTGGG + Intronic
906457961 1:46013847-46013869 GTGTGTGTGTATATGTGTGTTGG + Intronic
907516544 1:54996717-54996739 TTAAGTAAGGACATGTGTGTAGG - Intergenic
907640834 1:56188692-56188714 ATGTGTAAGCATGTGTGTGTGGG - Intergenic
908412061 1:63876690-63876712 GTGTGTGAGAACATGTGTTTAGG + Intronic
909085120 1:71161480-71161502 TGGTTTAAGAAGATGTGTGTGGG - Intergenic
909106474 1:71415902-71415924 GTGTGTATGTGGATGTGTGTGGG + Intronic
910342614 1:86204922-86204944 GTGTGTAAGCATATGTGTGTGGG - Intergenic
910662567 1:89689390-89689412 GTGAGTTAGAACATGTTTGAAGG + Intronic
911496190 1:98634318-98634340 GTTTGTATGTACGTGTGTGTGGG - Intergenic
911875336 1:103155192-103155214 GTGTGTATATATATGTGTGTGGG + Intergenic
912119340 1:106451025-106451047 GTGTGTATGTGCATATGTGTGGG - Intergenic
912201776 1:107465939-107465961 GTGTGTGTGCATATGTGTGTGGG + Intronic
912385269 1:109268320-109268342 GTATCTCAGGACATGTGTGTGGG + Intronic
912768756 1:112442479-112442501 GTGGGGAAGAAAATGTGTTTAGG - Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
912957419 1:114165337-114165359 GTGTCTAAGAGTGTGTGTGTAGG - Intergenic
913266390 1:117049180-117049202 GTGTGTGGAAACAGGTGTGTGGG + Intergenic
913413797 1:118582307-118582329 GTATACAAGAAGATGTGTGTAGG + Intergenic
915163062 1:153933159-153933181 GTGTTCAAGCACATCTGTGTGGG + Intronic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
915841212 1:159214991-159215013 CTTTGTAAGAACTTGTGTTTAGG - Intergenic
915882788 1:159689716-159689738 GTGTGCATGCACGTGTGTGTGGG - Intergenic
917709678 1:177671556-177671578 GTGTGTAAGAGCATGTGTTGAGG + Intergenic
917791315 1:178500937-178500959 GTGTGCAAGAGAGTGTGTGTTGG - Intergenic
918109411 1:181442392-181442414 GTGTGGGGGAACATGTGTGAAGG + Intronic
918525836 1:185463831-185463853 GTGTGCCAGAGGATGTGTGTAGG - Intergenic
919085420 1:192915406-192915428 TTGTGGAAGCACATGTCTGTTGG + Intergenic
920312333 1:205056057-205056079 GCATATAAGAAAATGTGTGTAGG + Intronic
921188499 1:212689808-212689830 GTGTGTGAGAGTGTGTGTGTCGG - Intronic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
921715602 1:218414214-218414236 GTGTGTGTGCACATGTGTTTAGG - Intronic
922475912 1:225906929-225906951 GTGTGTGTGCACATGCGTGTGGG + Intronic
922996991 1:229972016-229972038 GAGTGTATGTACATGTGAGTGGG - Intergenic
1063331179 10:5161049-5161071 GTGTGTATATATATGTGTGTGGG + Intergenic
1063956576 10:11273068-11273090 GTGCGTGAGAGTATGTGTGTGGG + Intronic
1064207874 10:13339716-13339738 GTATGTGAGAAGATGTGTGTAGG - Intronic
1065640498 10:27777634-27777656 GTATGTAAGAGGATGTGTGCAGG + Intergenic
1065667356 10:28076526-28076548 GTGTGTGCGCGCATGTGTGTGGG - Intronic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1067682975 10:48451806-48451828 GTGTGTAATTTTATGTGTGTGGG - Intronic
1067774817 10:49155501-49155523 GTGTGTAGGAAGCTGTGTGTTGG + Intronic
1068316861 10:55355933-55355955 GTGTGTAGGAAAATATGTCTTGG - Intronic
1068321167 10:55418521-55418543 GAGTGTAAGAAAATGTATGCTGG + Intronic
1068750879 10:60590739-60590761 GTATGCAGGAACATGTGAGTAGG - Intronic
1069795616 10:71049966-71049988 GTGTATAAGAGTATGTGTGTGGG - Intergenic
1070547238 10:77462562-77462584 GTGTGTAAGTGCATGTGTGAGGG - Intronic
1070802870 10:79253859-79253881 GTGTGCATGTACCTGTGTGTGGG - Intronic
1070823568 10:79377312-79377334 ATGTGTGTGCACATGTGTGTGGG + Intergenic
1070958883 10:80485207-80485229 GTGTGTAAGATAAAGAGTGTTGG + Intronic
1071701050 10:87936681-87936703 GTATGTATGCATATGTGTGTGGG - Intronic
1072768644 10:98117346-98117368 GTGTACAAGAAAATGTGTGTAGG - Intergenic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1072816167 10:98511606-98511628 GTGTGTGCGCACGTGTGTGTTGG + Intronic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1074390250 10:113051181-113051203 GTGTGTATGCACATGTATGAAGG - Intronic
1074833756 10:117269194-117269216 GTGTGTATGTGTATGTGTGTAGG - Intronic
1074844251 10:117383127-117383149 GTGTGTGTGTACATGTGTGTTGG + Intergenic
1074928264 10:118095800-118095822 GTACGTAAGAACTTGTGTGGTGG - Intergenic
1074935777 10:118180032-118180054 GTGTCTATCAACATGTGAGTGGG + Intergenic
1075483019 10:122798451-122798473 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1075913143 10:126143521-126143543 GTGTATATGTACATGTGTATGGG + Intronic
1076405192 10:130207135-130207157 GTGTGTGAGAGTGTGTGTGTGGG - Intergenic
1076726312 10:132415592-132415614 GTGTGTGAGTAAATGTGAGTGGG - Intronic
1076745970 10:132514681-132514703 GTGTGTATGCACATATGTATTGG + Intergenic
1077425084 11:2471872-2471894 GTGTGTGTGCACATGTGTATAGG + Intronic
1077425091 11:2471994-2472016 GTGTGTGTGCACATGTGTATAGG + Intronic
1077425094 11:2472046-2472068 GTATGTGTGCACATGTGTGTAGG + Intronic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1078086566 11:8236857-8236879 GTGTGTATGAGCATGCGTTTTGG + Intronic
1078477741 11:11646501-11646523 GTGTGTGTAAAAATGTGTGTGGG - Intergenic
1079286007 11:19133370-19133392 GTGTGTATATATATGTGTGTGGG - Intronic
1079970272 11:27028019-27028041 GTGTGTAAGAAAGTGTGTAAGGG + Intergenic
1081994764 11:47356289-47356311 GTGGGTTTGAACATGTGGGTGGG - Intronic
1082257394 11:50046454-50046476 GTGTGTAGGAAGATGACTGTTGG - Intergenic
1083256231 11:61497229-61497251 GTGTGTAAGTGTATATGTGTGGG + Intergenic
1083686567 11:64379693-64379715 GTGTGTAAGCACAAGTGTGTGGG + Intergenic
1083686588 11:64380183-64380205 GTGGGTTTGAACGTGTGTGTGGG + Intergenic
1083713306 11:64561772-64561794 GTGTTTAAGAACATGGGGTTTGG - Intronic
1084656313 11:70521674-70521696 GTGAGTGTGAGCATGTGTGTGGG + Intronic
1084676199 11:70636794-70636816 GTGTGTGTGAACATGTGTGTGGG + Intronic
1084676232 11:70637103-70637125 GTGTGTATGTGCACGTGTGTGGG + Intronic
1085471276 11:76759794-76759816 GAGTCTAAGAACCTGGGTGTTGG - Intergenic
1086114693 11:83236171-83236193 GTGTGTAAAATTATCTGTGTGGG + Intronic
1086846984 11:91762741-91762763 GTGTGTGAAATAATGTGTGTTGG - Intergenic
1088478547 11:110269305-110269327 GTGTGCAAGAACATCTGTTACGG - Intronic
1088652089 11:111966701-111966723 GTGTTTAAGAACCTGGGTTTTGG - Intronic
1089681284 11:120120332-120120354 GTGTGTGTGTACATGTGTGGGGG - Intronic
1090585557 11:128208166-128208188 GTGTGTATGTATGTGTGTGTTGG - Intergenic
1090833527 11:130437208-130437230 GTGTGTGTGCACATGTGTGTAGG - Intergenic
1091040840 11:132279737-132279759 GTGGGTATGGGCATGTGTGTGGG - Intronic
1091196925 11:133739142-133739164 GTGTGTGGGTATATGTGTGTGGG + Intergenic
1091345103 11:134847184-134847206 GTGTGTGTGCACGTGTGTGTAGG + Intergenic
1092632891 12:10403329-10403351 GTGTGTATACACAGGTGTGTTGG - Intronic
1092844766 12:12574006-12574028 GTGTGATGGCACATGTGTGTAGG + Intergenic
1092893343 12:12990020-12990042 GTATGTATGAGGATGTGTGTGGG - Intronic
1094221166 12:27995138-27995160 GTGTGTGTGAAAGTGTGTGTGGG - Intergenic
1094602936 12:31926259-31926281 GTGTGTAGGAGGATGTGAGTAGG - Intergenic
1094633578 12:32202267-32202289 GTGAGTAAGAACAAGTGTTCAGG + Intronic
1094650566 12:32371873-32371895 GGGTGTAAGACCAGGTGTGGTGG - Intronic
1095438548 12:42218846-42218868 GTGTCTAAGAAGATGAGTGGGGG + Intronic
1095551305 12:43443630-43443652 GTGCTTAAGAACATATGTATAGG + Intronic
1096773047 12:53948677-53948699 GTGTGTGTGAGCATGTGTTTCGG + Intergenic
1098484327 12:71003405-71003427 GTCTGTAAGAACATGAGAGAGGG - Intergenic
1098969224 12:76831948-76831970 GTTTGTTTGAACATTTGTGTAGG + Intronic
1099880333 12:88459847-88459869 GTGTGTGTGCACGTGTGTGTTGG + Intergenic
1101436767 12:104670816-104670838 GTGTGTGAGAATGTATGTGTGGG - Intronic
1101550910 12:105760707-105760729 GTGTGGACGCATATGTGTGTAGG + Intergenic
1101579359 12:106027816-106027838 GTGTATGAATACATGTGTGTTGG - Intergenic
1102029672 12:109732729-109732751 GTGTGTGTGTACACGTGTGTGGG - Intronic
1103639142 12:122334915-122334937 GTGTGTATGGACATGTGGGAAGG + Intronic
1103907223 12:124333994-124334016 GTGTGTGTGCGCATGTGTGTGGG + Intronic
1103971756 12:124677086-124677108 GTGTGTGCGGGCATGTGTGTGGG + Intergenic
1104149497 12:126069092-126069114 GGGTCTAAGAACCTGTGTTTAGG + Intergenic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1106486072 13:30173883-30173905 GTGTGTGTGCACATGTGTGTGGG - Intergenic
1106787582 13:33122421-33122443 GTGTGTGAGACCCTGTGTGATGG - Intronic
1107022006 13:35761422-35761444 GTGTGTATGTATGTGTGTGTAGG - Intergenic
1107022096 13:35762633-35762655 GTGTGTATGTATGTGTGTGTAGG - Intergenic
1107653911 13:42573012-42573034 GTGTACAAGAGGATGTGTGTAGG - Intronic
1107674636 13:42782265-42782287 GTGTGCATGAACATGCGTGAAGG + Intronic
1107732269 13:43360000-43360022 GGGTGTAAGACCGTGTTTGTCGG - Exonic
1107733634 13:43373573-43373595 GTGTGTATGTGTATGTGTGTGGG - Intronic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108966707 13:56315508-56315530 ATGTGAAAGAACATTTGAGTAGG - Intergenic
1109560471 13:64042643-64042665 GTGCGCACGCACATGTGTGTAGG + Intergenic
1109734443 13:66463680-66463702 ATTTGAAAGAAAATGTGTGTTGG + Intronic
1110370360 13:74733094-74733116 GTGTGTATGTGCATGTGTTTAGG - Intergenic
1110797693 13:79658984-79659006 GGCTGTAGGGACATGTGTGTTGG + Intergenic
1110973576 13:81800174-81800196 GTGAGGAAGAATATATGTGTGGG - Intergenic
1111058297 13:82979217-82979239 GTGTGTGGGTACACGTGTGTTGG + Intergenic
1111644280 13:91010555-91010577 GTGTGTAAGTGCACGTGTATAGG - Intergenic
1111841766 13:93458100-93458122 GGCTGAAAGAACATGTGTATGGG + Intronic
1111846583 13:93516742-93516764 GTGTATAAGAACATATATGTGGG + Intronic
1112672736 13:101659797-101659819 ATATGTAAGTATATGTGTGTAGG + Intronic
1113379503 13:109788583-109788605 GTGTGTATGATTGTGTGTGTTGG + Intergenic
1113870561 13:113557182-113557204 GTGTGTGTGCACATGTGTGTAGG + Intergenic
1115455221 14:33594193-33594215 GTATGTAGGAAGATATGTGTAGG - Intronic
1115520749 14:34230893-34230915 GTGTGTGCGCATATGTGTGTAGG - Intronic
1115807607 14:37069413-37069435 GTGTGTACAAATATGTGTTTAGG + Intronic
1118159553 14:63274793-63274815 GTGCTTAAGAACATGGGTGGTGG - Intronic
1118629913 14:67693532-67693554 GTGTGTATGTGCATGCGTGTGGG - Intronic
1119377665 14:74207574-74207596 GTATGTATGCACATGTGTGCAGG - Intergenic
1119885381 14:78136302-78136324 GTGTACAAGAGGATGTGTGTAGG + Intergenic
1119947575 14:78711121-78711143 GTTTTTAAGAGCATGTGTTTGGG + Intronic
1120085843 14:80271833-80271855 ATGTGAAAGAGCATGTCTGTTGG - Intronic
1120636455 14:86957616-86957638 CTGTTTAAGAATATATGTGTGGG + Intergenic
1120819972 14:88903054-88903076 GTGTGTGAGAGTGTGTGTGTGGG + Intergenic
1121702238 14:95963270-95963292 GTGTGTATGTGCCTGTGTGTGGG - Intergenic
1122088222 14:99321424-99321446 GGGTGTGAGTGCATGTGTGTGGG - Intergenic
1122088232 14:99321486-99321508 GTGTGTGAGCGCATGTGTATAGG - Intergenic
1122807487 14:104267410-104267432 GTGTGTGTGCACGTGTGTGTGGG - Intergenic
1122834913 14:104425864-104425886 GTGTGTTGGCACATGTGTTTCGG + Intergenic
1124237789 15:28004631-28004653 GTGTGTCAGACCATGTGTCTGGG - Intronic
1124250903 15:28106140-28106162 GTGTGTGTGCGCATGTGTGTGGG + Intergenic
1125622178 15:41073278-41073300 GTGTGTGAGTAGCTGTGTGTAGG - Intronic
1126236229 15:46388115-46388137 GTGTGGATGAACATGTATATAGG + Intergenic
1126859384 15:52869569-52869591 GTGTGAAAGAGCATGGGTTTGGG + Intergenic
1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG + Intronic
1127665848 15:61146443-61146465 GTGTGTATGTGTATGTGTGTTGG - Intronic
1127745928 15:61972482-61972504 GTGTGTATGTGCATGTGTGTTGG + Intronic
1128576339 15:68777857-68777879 GAGTGAAAGAACATGGGAGTGGG - Intergenic
1129262554 15:74376803-74376825 GTGTGTGAGAACATCTTTCTGGG + Intergenic
1130138440 15:81201270-81201292 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1130613828 15:85384918-85384940 GATTGTATGAACATTTGTGTGGG + Intronic
1131651781 15:94407756-94407778 GTGCACAAGTACATGTGTGTTGG - Intronic
1131729060 15:95260012-95260034 GTGTGTAAGGAGGTATGTGTGGG + Intergenic
1132505458 16:306156-306178 GTGTGTGTGTACGTGTGTGTGGG - Intronic
1133039218 16:3051174-3051196 GTGTGTGTGCACGTGTGTGTGGG + Intronic
1133108253 16:3528291-3528313 GTGTGTGGGAGCATGTGTGTGGG - Intronic
1134147676 16:11779786-11779808 GTGTGTGTGTACACGTGTGTGGG + Intronic
1135185047 16:20308421-20308443 GTCTGTTAGAATGTGTGTGTTGG + Intergenic
1135508066 16:23056325-23056347 GTGTGTAGGAAAAAATGTGTAGG - Intergenic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1136538563 16:30914906-30914928 GTGAGTTAGAACCTGTGAGTGGG - Intergenic
1137404931 16:48181913-48181935 GTGGTTAAGAACATGTGGTTTGG - Intronic
1137458384 16:48635773-48635795 GTGTGTATGTGCGTGTGTGTGGG + Intergenic
1137731313 16:50692859-50692881 GTGTGTGTGCACGTGTGTGTTGG + Intergenic
1138755614 16:59481027-59481049 ATGTGTAAGAATATGTGGGCTGG + Intergenic
1138757100 16:59501172-59501194 GTATGTAAGAACATTTATGAGGG + Intergenic
1140613269 16:76626998-76627020 GTGGGTATGAGCATGTGTGAAGG + Intronic
1140911201 16:79454661-79454683 GTTTGAAAGAACAGGTGTGTAGG - Intergenic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1141368502 16:83466022-83466044 GTGGTTCAGCACATGTGTGTAGG - Intronic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1141928899 16:87187511-87187533 GTATGTGTGTACATGTGTGTGGG + Intronic
1141928978 16:87188164-87188186 GTGTATGTGTACATGTGTGTAGG + Intronic
1142289888 16:89188911-89188933 GTGTGTGGGCACCTGTGTGTGGG - Intronic
1142289902 16:89189006-89189028 GTGTGTGGGCACCTGTGTGTGGG - Intronic
1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG + Intronic
1142639130 17:1275418-1275440 GTGTGTGAGTGAATGTGTGTGGG + Intergenic
1142639168 17:1275694-1275716 GTGTGTGTGAATGTGTGTGTGGG + Intergenic
1143360405 17:6364666-6364688 GTGTGTAATAGTAAGTGTGTAGG - Intergenic
1144356178 17:14448558-14448580 GTGTGTGTGGACTTGTGTGTTGG - Intergenic
1144672073 17:17138463-17138485 GGGTGGAAGTGCATGTGTGTGGG - Intronic
1144747489 17:17625516-17625538 GTGTGTGTGAATATGTGAGTGGG - Intergenic
1146227033 17:31075894-31075916 GTGTGTATGCATCTGTGTGTTGG - Intergenic
1146290413 17:31602711-31602733 GTGTGCAAGCACGTGTGTGTGGG - Intergenic
1146468608 17:33106853-33106875 GTGTGAAAAAATATGTGTGTGGG + Intronic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1146733021 17:35212150-35212172 CTGTGTATGAGCAAGTGTGTTGG + Intergenic
1146925450 17:36741377-36741399 GTGTGTAAGAGTGTGTGTGCTGG + Intergenic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1148029173 17:44608210-44608232 GTATGTACCCACATGTGTGTGGG - Intergenic
1148228361 17:45915394-45915416 GTGTGCATGAGCATGTGTGTGGG + Intronic
1148355921 17:46975737-46975759 GTGTGTACTAACGTGTGTTTGGG - Intronic
1148552511 17:48558904-48558926 GTGTGTGTGCCCATGTGTGTAGG + Intronic
1148789831 17:50166914-50166936 GTGTGTGTGAAGGTGTGTGTGGG - Intronic
1148855619 17:50577778-50577800 GTGTGCAAGTGCACGTGTGTGGG + Intronic
1151511503 17:74563475-74563497 GTGTGCAAGAGCTGGTGTGTGGG - Intergenic
1151864979 17:76795510-76795532 GTATGCAGGAAGATGTGTGTAGG + Intergenic
1152533882 17:80939328-80939350 GTGTGCACGCACATGTGGGTTGG - Intronic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1154351866 18:13590053-13590075 GTGTGTGACTGCATGTGTGTGGG + Intronic
1155867669 18:30985922-30985944 GTGTGCAAGTGCATGTGTGTGGG + Intergenic
1156219544 18:35037865-35037887 GTCTGTAGGAATATGTGAGTGGG + Intronic
1156719543 18:40052974-40052996 CTGTTGAAGAACATTTGTGTTGG + Intergenic
1156868690 18:41918098-41918120 GTGGGTAAGAAAATCTGTTTGGG + Intergenic
1157070899 18:44407022-44407044 GTGTGTAAGAACATCAGTAAAGG + Intergenic
1157312911 18:46565658-46565680 GTGTATAGGAGGATGTGTGTAGG - Intronic
1157700930 18:49761328-49761350 GTGTGGAGGGAAATGTGTGTGGG - Intergenic
1158003612 18:52647073-52647095 GTGTTAAAGAACATGTATTTGGG - Intronic
1159018684 18:63124740-63124762 GTGTGTAACCACATTTGTCTGGG + Exonic
1159871014 18:73759758-73759780 GTGGGGAAGAACAGGTGTGTGGG - Intergenic
1160015138 18:75134356-75134378 GTGTGACTGAAAATGTGTGTAGG + Intergenic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1162715396 19:12628293-12628315 GTGTGTTAGAACACTTGTGTGGG - Exonic
1164686677 19:30171079-30171101 GTGTGAGTGAACATGTGTATAGG + Intergenic
1164686686 19:30171265-30171287 GTGTGAGTGAATATGTGTGTGGG + Intergenic
1165192156 19:34073905-34073927 GTGTGTATGTGCATGTGTGCGGG + Intergenic
1165391122 19:35539560-35539582 GTGTGTATTTGCATGTGTGTGGG - Intronic
1167091905 19:47350049-47350071 GTGTGTATGTACATAGGTGTGGG + Intronic
1167194740 19:48020458-48020480 TTGGGTGAGAACATGTGTGTTGG + Intronic
1167765357 19:51478915-51478937 GTGTGTAACACCACATGTGTGGG - Intronic
1168013621 19:53554410-53554432 GTGTGCACGCACATGCGTGTCGG + Intronic
1168171136 19:54590458-54590480 GTATGGAAGATCAGGTGTGTGGG - Intronic
924991836 2:319150-319172 GTGTGTGTGGGCATGTGTGTGGG + Intergenic
925398787 2:3557103-3557125 GCATGCAAGAAGATGTGTGTGGG - Intronic
925904004 2:8528438-8528460 GTGTGTATGAGCATGGGTGTGGG - Intergenic
927537271 2:23873477-23873499 GTGTGTGGGAGGATGTGTGTAGG - Intronic
927653299 2:24925125-24925147 GGGTGTAAGAGCGTGTGTGTAGG + Intergenic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
928222373 2:29415050-29415072 GTGTGTGTATACATGTGTGTGGG - Intronic
928395170 2:30938044-30938066 GTGTGTAAGTATGTGTGTGGTGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929315853 2:40477751-40477773 GTGTGTGTGCACGTGTGTGTAGG + Intronic
929795786 2:45057395-45057417 GTGTGTGTGTACCTGTGTGTGGG + Intergenic
930816635 2:55605135-55605157 GTGTTTAAAAATGTGTGTGTAGG - Intronic
931937517 2:67214944-67214966 GTGTGGGTGAATATGTGTGTGGG - Intergenic
932042558 2:68317058-68317080 CTCTGTAAGAAAAGGTGTGTTGG - Intronic
932882565 2:75517662-75517684 GTGTGTGAGACTGTGTGTGTGGG - Intronic
933335975 2:80960041-80960063 GTGTGTATGAGTGTGTGTGTAGG + Intergenic
934572401 2:95381350-95381372 CTGTGTGAGAACTTGTGTGAGGG - Intronic
934572404 2:95381380-95381402 GTGTGTGTGAACTTGTGTGAGGG - Intronic
935120720 2:100181309-100181331 GTGTGTATGTACATGTGTTGGGG + Intergenic
935857759 2:107293740-107293762 GTGTGTGTGCACATGTGTGAAGG - Intergenic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
937503777 2:122513366-122513388 GTGTGTATGTGGATGTGTGTAGG + Intergenic
937688926 2:124731704-124731726 ATGTGTAAGAATGTGTGTATGGG + Intronic
939811087 2:146833210-146833232 ATGAGTGAGAACATGTGTTTGGG - Intergenic
940718304 2:157254041-157254063 ATGTGAAACAGCATGTGTGTCGG + Intergenic
942219019 2:173751011-173751033 GTGTGAGAGAACATGTGTGAGGG + Intergenic
942937752 2:181578238-181578260 GTGTGTATATATATGTGTGTGGG + Intronic
942985532 2:182136379-182136401 GTGTGTATGAGTGTGTGTGTGGG - Intergenic
945070225 2:205981929-205981951 CTGTATAAGCACATGTGAGTAGG - Intergenic
945902260 2:215552094-215552116 GTATATGAGAAGATGTGTGTAGG + Intergenic
946033402 2:216723109-216723131 GTGTGCAAGGTCAGGTGTGTGGG - Intergenic
948354219 2:237364835-237364857 GTGTGGGTGTACATGTGTGTGGG + Intronic
1171051467 20:21863074-21863096 GTGTATTTGTACATGTGTGTGGG + Intergenic
1172767410 20:37358265-37358287 GGGAGTAAGGGCATGTGTGTGGG + Intronic
1172825675 20:37782367-37782389 GTGTGTGTGCACATATGTGTGGG - Intronic
1172923275 20:38506145-38506167 GTATATAGGAAGATGTGTGTAGG + Intronic
1172977435 20:38917608-38917630 GTGTGTAAGTCCATTTGAGTTGG - Intronic
1173163205 20:40667677-40667699 GTGTGTACAAAAATGTGTGTTGG + Intergenic
1173271232 20:41537417-41537439 GTGTATGAGAAGATGTGTATGGG + Intronic
1174957746 20:55118744-55118766 GTGTATATGTGCATGTGTGTGGG - Intergenic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1176176902 20:63732370-63732392 GTGTGTGCGCGCATGTGTGTGGG + Intronic
1178295961 21:31410368-31410390 GTGTGTAAGAGTGTGTGTGACGG + Intronic
1178322662 21:31617214-31617236 GTGTGTGTGTACATGTGTGGCGG - Intergenic
1178388998 21:32183137-32183159 GTGTGTGAGTACAAGTGTGTGGG - Intergenic
1178439431 21:32586403-32586425 GTGTGTGAGAGGTTGTGTGTGGG + Intronic
1178439441 21:32586463-32586485 GTGTGTGAGAGGTTGTGTGTGGG + Intronic
1178530922 21:33375204-33375226 GTGTGAAGGAAAATGTGTCTTGG - Intergenic
1179135752 21:38678765-38678787 TTGAGTAAGAACCTGTTTGTGGG - Intergenic
1179191441 21:39125671-39125693 GTGTGTGAGTACATGTGTGTTGG - Intergenic
1179317500 21:40257243-40257265 GTGTGCAGGAGGATGTGTGTAGG - Intronic
1179393209 21:41012572-41012594 GTGTGTGAGTGAATGTGTGTGGG - Intergenic
1179399023 21:41067126-41067148 GTGTGTATGTATGTGTGTGTGGG - Intergenic
1179467290 21:41584779-41584801 GGGTGTATGTATATGTGTGTGGG - Intergenic
1180172839 21:46068990-46069012 GTGTGTATGCACATGTGCCTGGG + Intergenic
1180761569 22:18213644-18213666 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1180774098 22:18410966-18410988 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181070207 22:20329979-20330001 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181132113 22:20738117-20738139 GTGTGTAGGCAGGTGTGTGTAGG + Intronic
1181193201 22:21157916-21157938 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181216244 22:21334685-21334707 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1181765534 22:25089121-25089143 GTGTGTAGGAGGATGTGTGTAGG + Intronic
1182220775 22:28756858-28756880 TTGTGTAAGAGCATGTGTACAGG - Intronic
1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG + Intronic
1184491724 22:44813734-44813756 GTGTGTATGTAGGTGTGTGTAGG - Intronic
1184833351 22:47005359-47005381 GTGTGTACAGACATGTGTGGAGG - Intronic
1184833426 22:47006025-47006047 GTGTGTAAAGGCATGTGTATAGG - Intronic
949309716 3:2683315-2683337 GTGTGTGTGTACATGTGTGCAGG - Intronic
949715502 3:6926069-6926091 GGGTGTACGTGCATGTGTGTGGG - Intronic
950627079 3:14255115-14255137 GTGTGTCAGAATGTGTGTTTTGG + Intergenic
950627109 3:14255390-14255412 GTGTGTTGGAATGTGTGTGTTGG + Intergenic
950824645 3:15805000-15805022 CTACGTAAGTACATGTGTGTTGG - Intronic
950908021 3:16556703-16556725 ATGTGTAAGAACATGAGGGCAGG - Intergenic
951780342 3:26355873-26355895 AAGTATAAGAAGATGTGTGTAGG - Intergenic
951927135 3:27920761-27920783 GTGAGTGAGTACATTTGTGTTGG + Intergenic
952761171 3:36915489-36915511 GTGGGAAGGCACATGTGTGTTGG - Intronic
953004838 3:38968581-38968603 GTGTGTGTGCACATGTGTGTTGG - Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
955157824 3:56434657-56434679 GTATGAAAGGACATCTGTGTGGG + Exonic
955194733 3:56794708-56794730 AAGTGTAAGAGGATGTGTGTAGG - Intronic
955661410 3:61303445-61303467 TTGTGTAAGAACATGGGCTTTGG - Intergenic
956359393 3:68430708-68430730 GTGGGTAACAACATGTGTGGAGG - Intronic
956801331 3:72762072-72762094 GTATGTATGTACATGTTTGTGGG - Intronic
957171469 3:76742809-76742831 GTATGTGTGAATATGTGTGTGGG - Intronic
957238338 3:77624356-77624378 GTGTATTAGAACGTGGGTGTGGG + Intronic
957709442 3:83835921-83835943 GTGTGTAAGGGTATCTGTGTGGG - Intergenic
959887445 3:111519038-111519060 GTGTGTATGCATGTGTGTGTGGG - Intronic
960354978 3:116640478-116640500 GTGTGTAAATTAATGTGTGTAGG - Intronic
960446335 3:117753462-117753484 GTGTGTACGTATATGTGTGTCGG + Intergenic
960992868 3:123323171-123323193 GTGTGGAAGAACAGGGCTGTGGG - Intronic
961716523 3:128861356-128861378 GTGTGTGAGCACATGTGTGATGG - Intergenic
961805174 3:129484029-129484051 GTGTGTGAGTACGTGTGTGATGG + Intronic
961861043 3:129916934-129916956 GTGTGTGTGAATATGTGTGCCGG + Intergenic
963005341 3:140721881-140721903 GTGTGTATGTGTATGTGTGTTGG - Intergenic
963145919 3:141994163-141994185 TTGTGTTTGTACATGTGTGTAGG + Intronic
963223785 3:142839973-142839995 GTGTGTGTGAATATATGTGTAGG + Intronic
966555543 3:181255713-181255735 GTGTGTGTGCACGTGTGTGTAGG + Intergenic
968706215 4:2079514-2079536 GTGTGTGTGCACGTGTGTGTTGG + Intronic
968891025 4:3368598-3368620 GTGTGTGGGTACCTGTGTGTGGG + Intronic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
969301430 4:6299571-6299593 GTGTGTGTGAATGTGTGTGTAGG + Intronic
969301442 4:6299643-6299665 GTGTGTGTGAATGTGTGTGTAGG + Intronic
969301450 4:6299691-6299713 GTGTGTGTGAATGTGTGTGTAGG + Intronic
969301463 4:6299768-6299790 GTGTGTGTGAATGTGTGTGTAGG + Intronic
969510720 4:7616276-7616298 GTGTGTATGTATATGTGAGTGGG - Intronic
969514610 4:7639440-7639462 GTGTGTGAGTGCATGTGTGTGGG + Intronic
969514668 4:7639997-7640019 GTGTGAAAGTGCATGTCTGTGGG + Intronic
970385800 4:15555294-15555316 CTGTTTAAGAACATGGGTGCTGG + Intronic
970475299 4:16415995-16416017 GTTTGAAATAACATTTGTGTTGG + Intergenic
971440013 4:26674559-26674581 GTGTTTAAAAACATGGGTTTTGG + Intronic
972711584 4:41601554-41601576 ATGTGTAAGGACATGTGTGGTGG + Intronic
972943187 4:44221940-44221962 GAGTGGAATAACATGTGTGATGG - Intronic
973793457 4:54399724-54399746 GTGTGTGAGAAAATATGTGTGGG + Intergenic
974756497 4:66215664-66215686 GTGTGTGTGCATATGTGTGTTGG - Intergenic
975185620 4:71399102-71399124 GTGTATATGAGGATGTGTGTAGG + Intronic
975464340 4:74692529-74692551 GTGTGTGAGAGGATGTGTGTAGG - Intergenic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
977540173 4:98308269-98308291 GTGTGTATATATATGTGTGTGGG - Intronic
978202883 4:106043753-106043775 GTGTGTATGTATATCTGTGTGGG + Exonic
978292207 4:107154769-107154791 GTGTGTATGGATATATGTGTGGG - Intronic
979414459 4:120418828-120418850 GTGTGTAAGAACATGGCTTTTGG + Intergenic
980474500 4:133294943-133294965 GTGTGTGTGCACATGTGTGTTGG + Intergenic
982776442 4:159446352-159446374 GTGTGTAAATGCATCTGTGTAGG + Intergenic
982780512 4:159486237-159486259 GTGTATATGTACATGTGTATGGG - Intergenic
982849935 4:160300304-160300326 GTGTGTGAGAGGATGTGTGTAGG - Intergenic
983745388 4:171192160-171192182 ATGTTTAGGAATATGTGTGTAGG - Intergenic
984205737 4:176785814-176785836 GTATGCATGAATATGTGTGTGGG + Intronic
984230213 4:177088143-177088165 GTGTATATGAATATGTGTGTGGG - Intergenic
984587831 4:181583005-181583027 GTGTGCATGCACATGTGTGTGGG - Intergenic
984699376 4:182808659-182808681 GTGTGCACGCACATGTGGGTGGG + Intergenic
985490945 5:178865-178887 GTATATAGGAGCATGTGTGTAGG - Intronic
985674083 5:1221414-1221436 GTGTGTGTGCCCATGTGTGTGGG - Intronic
985810956 5:2084554-2084576 ATGTGTAAGAACACGAGTGAAGG + Intergenic
985833777 5:2255885-2255907 ATGTGTATGTGCATGTGTGTGGG + Intergenic
985874158 5:2582710-2582732 TTGTGTGTGTACATGTGTGTGGG - Intergenic
986187064 5:5453973-5453995 GTGCGTATGAACATATGGGTAGG - Intronic
986799015 5:11240615-11240637 GTGTGTATGTACGTCTGTGTTGG - Intronic
986855241 5:11861083-11861105 GTATGTCAGAACATGTATGTGGG - Intronic
986974409 5:13379081-13379103 GTGTGTACATATATGTGTGTGGG + Intergenic
987272274 5:16323700-16323722 GTGACTAAGATCATGTGGGTAGG + Intergenic
987542044 5:19268780-19268802 GTGTGTATGTATCTGTGTGTGGG - Intergenic
988639478 5:33025677-33025699 GTGTGTGAGGACATGAGTTTAGG - Intergenic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
990250912 5:53914136-53914158 GTGTGTGAGAGTGTGTGTGTGGG - Intronic
990701662 5:58481281-58481303 GTGAGTAAGAGCATGTGTATGGG + Intergenic
990726541 5:58761637-58761659 GTGAGTGTGTACATGTGTGTGGG - Intronic
990770977 5:59244803-59244825 GTGTGTGTGAGCATGTTTGTGGG + Intronic
990825250 5:59892435-59892457 GTGTGTGCGAGCTTGTGTGTAGG - Intronic
991331280 5:65495145-65495167 GTCTGTAAAAACATGGGGGTGGG + Intergenic
991372787 5:65937005-65937027 GTATGTAAGAACATAAGTTTTGG + Intronic
991965910 5:72090841-72090863 GCATGTAAGAACATATTTGTAGG - Intergenic
993206265 5:84883484-84883506 GTGTGTATGTATGTGTGTGTTGG + Intergenic
993547947 5:89236057-89236079 GTGTGTATGTGTATGTGTGTGGG + Intergenic
993818815 5:92588255-92588277 GTGTTTATGTATATGTGTGTGGG + Intergenic
994851667 5:105062434-105062456 GTGTGTGTGCACATGTGTGCAGG + Intergenic
995844904 5:116483040-116483062 GGGTGTGAGAATATGTTTGTGGG + Intronic
996463535 5:123773716-123773738 GTGCGTAAGAAGAGGTTTGTTGG + Intergenic
997184211 5:131865702-131865724 GTGTGTATGTGCATATGTGTTGG + Intronic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
997707006 5:135965121-135965143 GTGTGTATGTGCATGTGTGAAGG - Intergenic
998597981 5:143554161-143554183 GTGTGTAAACACATATGTATGGG + Intergenic
998728778 5:145049793-145049815 GTGTGTATATATATGTGTGTGGG + Intergenic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999049582 5:148507886-148507908 GTGTACAAGAACTTCTGTGTGGG - Intronic
999911000 5:156199060-156199082 GTGTGTATCTACATGTGTTTAGG - Intronic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1001844985 5:174914496-174914518 GTGTGTGTGCACGTGTGTGTTGG - Intergenic
1002076608 5:176712247-176712269 GGGTGGGAGAACCTGTGTGTAGG - Intergenic
1002355282 5:178623507-178623529 GCCTGTAAGACCCTGTGTGTTGG - Intronic
1003603309 6:7538647-7538669 GTGTGTATGTGCATGTGTGTGGG + Intergenic
1003776209 6:9368435-9368457 GTGTGTGAGAATGTGTGTGGGGG - Intergenic
1003893902 6:10588851-10588873 GTGTGTATGTGTATGTGTGTGGG + Intronic
1004744377 6:18495394-18495416 CTGTGAAGGAACATCTGTGTTGG + Intergenic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1005281136 6:24275803-24275825 GTTTTTAACAACATTTGTGTTGG - Intronic
1007339779 6:41183582-41183604 GTGTGTGTGAATATGTGTCTGGG - Intergenic
1008055768 6:46944490-46944512 GTGTGTAGGAAGATGGGGGTAGG - Intronic
1008426734 6:51367208-51367230 GTGTGTATGAATGTGTGTGTAGG + Intergenic
1009457310 6:63872320-63872342 GTGTGTGTGCACAAGTGTGTAGG + Intronic
1009578561 6:65500116-65500138 GTGACTGAGAACATGTGTTTTGG - Intronic
1009774104 6:68182514-68182536 GTGTGTATGAATGTGTGTGAAGG - Intergenic
1010059628 6:71607539-71607561 GTGTTTAAGGACTTGTCTGTGGG + Intergenic
1010923185 6:81710135-81710157 GTGTGTATATATATGTGTGTGGG + Intronic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1011716573 6:90111658-90111680 GTGTATAGGAAGATGTGTATGGG - Intronic
1012136985 6:95570602-95570624 CAGTGTAAGAGTATGTGTGTGGG - Intergenic
1012820930 6:104083917-104083939 GTGTGGAATAACATGAGGGTGGG - Intergenic
1013318924 6:108967606-108967628 GTGTGCAGGAAGATGTGTGTAGG - Intronic
1014597660 6:123365540-123365562 GTGTGTAAGGGTATGTGTGCAGG + Intronic
1014785908 6:125619046-125619068 GGGTGTATGCACATGTGTGTGGG + Intergenic
1014876503 6:126667495-126667517 TTGTGTAATACCTTGTGTGTTGG - Intergenic
1015213788 6:130726824-130726846 CTGTTTAAGAACATTTTTGTAGG - Intergenic
1015608801 6:134991260-134991282 GTGTGTAAGAGGAAGTGTGTAGG - Intronic
1016226091 6:141740065-141740087 GTGTTTAAAAACCTGTGTATAGG + Intergenic
1016904604 6:149136383-149136405 GTGTGTGTGACTATGTGTGTGGG + Intergenic
1017769022 6:157630776-157630798 CTGTGTAAGGGTATGTGTGTGGG - Intronic
1017798529 6:157870175-157870197 ATGTGTGAGAGCATGAGTGTGGG - Intronic
1018638525 6:165885825-165885847 ATGTGTATGCATATGTGTGTTGG + Intronic
1018698510 6:166408993-166409015 GTGTGTGTGCACAGGTGTGTGGG - Intergenic
1018698518 6:166409145-166409167 GTGTGTATGTACATATGTGTAGG - Intergenic
1018837373 6:167495415-167495437 GTGTGTATAAGCATGTGTGTAGG - Intergenic
1019075610 6:169385266-169385288 GTGTGACAGAACATGAGTGAGGG - Intergenic
1019389154 7:775872-775894 GTGTGCCGGAAGATGTGTGTGGG + Intronic
1019553915 7:1619308-1619330 GTGTGTAGGTGTATGTGTGTCGG + Intergenic
1020017129 7:4837660-4837682 GTGTGTGGGTGCATGTGTGTTGG - Intronic
1020114677 7:5469886-5469908 GTGTGCGAGGGCATGTGTGTGGG + Intronic
1020460605 7:8425839-8425861 GTGAATAGGAAGATGTGTGTTGG + Intergenic
1020729259 7:11860996-11861018 ATGTGTGAGTATATGTGTGTAGG - Intergenic
1020816425 7:12911458-12911480 GTGAGTGAGAACAAGTGAGTGGG + Intergenic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1021464083 7:20922053-20922075 GTGTGTGTGCACGTGTGTGTGGG + Intergenic
1022025244 7:26442242-26442264 GCATTTAAAAACATGTGTGTGGG + Intergenic
1022957805 7:35397505-35397527 GTGTGTGTGCACATGTGTGTGGG + Intergenic
1023296686 7:38722206-38722228 GTGTGTATACATATGTGTGTGGG - Intergenic
1023761760 7:43470726-43470748 GTGTGTGAGCATGTGTGTGTAGG - Intronic
1023966666 7:44966423-44966445 GTATGTGAGGACATGTGTATGGG - Intronic
1023966678 7:44966490-44966512 GTGTGTGAGCACATGCATGTGGG - Intronic
1024473678 7:49788927-49788949 ATGTGTGAGAATATGAGTGTGGG + Intronic
1024473694 7:49789165-49789187 GTGTGTGTTAGCATGTGTGTGGG + Intronic
1026391538 7:69907485-69907507 GTTTGTGAGAGGATGTGTGTTGG - Intronic
1026567071 7:71497997-71498019 ATGTGTATGCACATGCGTGTGGG + Intronic
1027591311 7:80122388-80122410 GTATACAGGAACATGTGTGTGGG - Intergenic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1028440243 7:90851349-90851371 GTGTGTATGAATGTGTGTGTGGG + Intronic
1028622604 7:92841531-92841553 GTCTGAAAGAAAATGTGTTTAGG + Intergenic
1028872734 7:95786880-95786902 CTGTATATGGACATGTGTGTGGG + Intronic
1029654687 7:101916486-101916508 GTCTGTAAGAACACGTGGGCAGG + Intronic
1029852135 7:103473608-103473630 GTGTGTATGTACATATGTGGGGG - Intronic
1030881993 7:114891373-114891395 GTATATAAGAGGATGTGTGTAGG - Intergenic
1030960839 7:115920005-115920027 TTATGTAAGAAGATGTGTTTTGG + Intergenic
1032425124 7:131816443-131816465 CTGTGTAAACACATGTGTATGGG + Intergenic
1033638042 7:143230654-143230676 GTGTGTGTGAATGTGTGTGTTGG - Intergenic
1033638045 7:143230747-143230769 GTGTGTGTGAATGTGTGTGTTGG - Intergenic
1033638049 7:143230809-143230831 GTGTGAATGAATGTGTGTGTTGG - Intergenic
1033638053 7:143230915-143230937 GTGTGTATGTGAATGTGTGTTGG - Intergenic
1033638060 7:143231046-143231068 GTGTGTATGAATGTGTGTGTTGG - Intergenic
1033820088 7:145124866-145124888 GTGTGTGTGGGCATGTGTGTGGG + Intergenic
1033989676 7:147267993-147268015 AAGTGAAAGACCATGTGTGTGGG - Intronic
1034480072 7:151313016-151313038 GAGTGTCAGTGCATGTGTGTGGG + Intergenic
1034480152 7:151313671-151313693 GTGTGTGAGTGCATGTGTATGGG + Intergenic
1034897068 7:154883026-154883048 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034897073 7:154883092-154883114 GTATGTGAGAGCATGTGTATGGG - Intronic
1034897079 7:154883253-154883275 GTGTGTGAGAGCAGGTGTATGGG - Intronic
1034897087 7:154883409-154883431 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034897114 7:154884067-154884089 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034897118 7:154884125-154884147 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034937154 7:155207664-155207686 GTGTGGGAGTGCATGTGTGTGGG + Intergenic
1034937188 7:155207891-155207913 GTGTGTGGGAATGTGTGTGTGGG + Intergenic
1034937242 7:155208197-155208219 GTGTGTATGACTCTGTGTGTGGG + Intergenic
1034937307 7:155208505-155208527 GTGTGTAGGAATGGGTGTGTGGG + Intergenic
1034937340 7:155208656-155208678 GTGTGTGGGAATGTGTGTGTGGG + Intergenic
1034937351 7:155208706-155208728 GTGTGTGGGAATGTGTGTGTGGG + Intergenic
1034937369 7:155208786-155208808 GTGTGTGGGAATGTGTGTGTGGG + Intergenic
1035019698 7:155793655-155793677 GTGTGTGAATGCATGTGTGTGGG - Intergenic
1035288311 7:157820500-157820522 ATGTGTAAGAATGCGTGTGTTGG - Intronic
1035288316 7:157820592-157820614 ATGTGTAAGAATGCGTGTGTGGG - Intronic
1035336397 7:158130399-158130421 GTGTGTATGAGTGTGTGTGTTGG - Intronic
1035336401 7:158130501-158130523 GTGTGTATGAGTGTGTGTGTTGG - Intronic
1035336420 7:158130906-158130928 GTGTGTATGAGTGTGTGTGTCGG - Intronic
1035336440 7:158131369-158131391 GTGTGTATGAGTGTGTGTGTCGG - Intronic
1035336447 7:158131514-158131536 GTGTGTATGAGTGTGTGTGTCGG - Intronic
1035362698 7:158323876-158323898 GTGTGTGAAAATGTGTGTGTTGG - Intronic
1035395296 7:158531026-158531048 GTGTGTGTGAACATGTGCATGGG + Intronic
1035657489 8:1320885-1320907 GTCTGTATGCACAGGTGTGTAGG + Intergenic
1035704259 8:1663073-1663095 GTGCGTTTGTACATGTGTGTGGG + Intronic
1035877416 8:3206523-3206545 GTGTGTATGTATGTGTGTGTGGG + Intronic
1036044620 8:5125643-5125665 ATGTTTAAGAACATGTGTTATGG + Intergenic
1036086485 8:5618278-5618300 GTGTGTGAGCATGTGTGTGTGGG + Intergenic
1036108726 8:5874753-5874775 GTGTGTAGCAACAGGTCTGTGGG + Intergenic
1037716669 8:21406853-21406875 GTGTGTATATGCATGTGTGTGGG + Intergenic
1038930932 8:32192835-32192857 GTGTGTGAGTTTATGTGTGTAGG - Intronic
1039087891 8:33798128-33798150 GTATACAAGAAGATGTGTGTAGG - Intergenic
1039593327 8:38768916-38768938 GTGTGTGTGACTATGTGTGTGGG + Intronic
1039954580 8:42197208-42197230 GTGTGTAGGCACCTGTGTGTAGG + Intronic
1041925842 8:63235470-63235492 GTATATAAGAGGATGTGTGTGGG + Intergenic
1042035553 8:64529663-64529685 ATGTGTGACAACATGTGTGAGGG - Intergenic
1042844844 8:73159569-73159591 GTGTGTGAGCATGTGTGTGTAGG - Intergenic
1043160582 8:76841573-76841595 GAGTGTATGCAAATGTGTGTCGG + Intronic
1043389263 8:79776369-79776391 GTGTGTATGCACATGTGTGTGGG - Intergenic
1045350042 8:101330088-101330110 GTGTATACGCACATGTGTGAGGG - Intergenic
1045559924 8:103251373-103251395 GTGAGTAAGAGCATGTGTGTTGG - Intergenic
1045681812 8:104668648-104668670 GTGATTAAGAACATGGGTTTGGG + Intronic
1045878386 8:107009772-107009794 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1046739020 8:117809171-117809193 GTATGTATGTGCATGTGTGTAGG + Intronic
1047617801 8:126577437-126577459 GTGTGTGTGTATATGTGTGTTGG - Intergenic
1047641592 8:126827030-126827052 ATGTGTAAGAACATGAGAGAAGG + Intergenic
1049398606 8:142413620-142413642 GTGTGTGAGAGTGTGTGTGTGGG - Intergenic
1049525486 8:143124117-143124139 GTGTGCATGTACATGTGTGAGGG - Intergenic
1049525582 8:143125124-143125146 GGGTGTATGTACATGTGTGAGGG - Intergenic
1049563219 8:143323828-143323850 GTGGGTGTGAACATGTGTGTAGG - Intronic
1050715696 9:8522686-8522708 GTGTTTAAGTAAATGTGTTTTGG + Intronic
1052571474 9:30229618-30229640 GAGTGAAAGATCATGTATGTGGG + Intergenic
1053289665 9:36871664-36871686 GTATGTGAGAACATGTGTTTGGG - Intronic
1053874236 9:42526346-42526368 GTGTGTGTGTACATGTGTGTGGG + Intergenic
1054268097 9:62940408-62940430 GTGTGTGTGTACATGTGTGTGGG - Intergenic
1055289900 9:74771408-74771430 GTGTGTGTGCGCATGTGTGTAGG - Intronic
1055453600 9:76453262-76453284 GTGGGTAGGAAAAGGTGTGTAGG + Intronic
1055662739 9:78521393-78521415 GTGTGAAAGAAAAAGAGTGTCGG + Intergenic
1055693221 9:78856428-78856450 GTGAGTAAGAGCATGAGGGTGGG + Intergenic
1056768303 9:89458954-89458976 GTGTGTAGGCACATGTGTGTAGG - Intronic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1056926830 9:90842485-90842507 GTGTGTATGTGTATGTGTGTGGG + Intronic
1056961476 9:91128204-91128226 GTGTGCATGTACATGTTTGTGGG + Intergenic
1057127629 9:92631509-92631531 GAGTGCAAGAACTTTTGTGTAGG + Intronic
1058321237 9:103634076-103634098 GTGTGTGTGCACGTGTGTGTAGG - Intergenic
1058420192 9:104826192-104826214 GTGGGTATGCGCATGTGTGTGGG - Intronic
1058939057 9:109796688-109796710 GTGAGAGAGATCATGTGTGTAGG + Intronic
1060942210 9:127549470-127549492 GTGTGAGTGTACATGTGTGTGGG - Intronic
1061005187 9:127924901-127924923 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1061416217 9:130448299-130448321 GTGTGCATGCACACGTGTGTGGG - Intronic
1061526125 9:131164256-131164278 GTGTGTAAGTGTGTGTGTGTTGG + Intronic
1061861373 9:133470221-133470243 GTGTGTATGTATATGTGTGTGGG + Exonic
1062355775 9:136161371-136161393 GTGTGTGTGCATATGTGTGTGGG + Intergenic
1185480145 X:439799-439821 GTGTGTATGAATGTGTGTGTGGG - Intergenic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1185891114 X:3822743-3822765 GTGTGTGAGCACATGAGTGATGG + Intronic
1186039625 X:5461685-5461707 GTGTAGAAGAAAATGTGAGTGGG - Intergenic
1187711123 X:22055516-22055538 GTGTGTAAAAGCTTGTGTTTTGG + Intronic
1188251112 X:27896156-27896178 GTGTACAAGAGCATGTGAGTAGG + Intergenic
1189363853 X:40373235-40373257 GTGTGTATGTGCATGTGTATAGG + Intergenic
1189364221 X:40375836-40375858 GTGTGTACACGCATGTGTGTGGG + Intergenic
1189556942 X:42154869-42154891 TTCTTTAAGAACATGCGTGTAGG + Intergenic
1189831688 X:44981070-44981092 TTCTGTAACAAAATGTGTGTGGG + Intronic
1190709356 X:53055292-53055314 GTGTGAAAGAGAAAGTGTGTAGG + Intronic
1191898117 X:66014984-66015006 GAGTGAAAGAACATGTGATTTGG + Intergenic
1195029599 X:100913367-100913389 GTGTGTATGTGTATGTGTGTAGG - Intergenic
1195670681 X:107467319-107467341 GAGTGCAAGCACATGTGTGGTGG + Intergenic
1196644710 X:118105056-118105078 GTGTGTTGGTATATGTGTGTGGG - Intronic
1196943142 X:120797533-120797555 CTGACTAAGAACATGTGGGTGGG - Intergenic
1197180231 X:123527403-123527425 GTGTGTGAGAATGTGTGTGTAGG + Intergenic
1199298749 X:146188053-146188075 GTGTCTAATAACATCAGTGTAGG + Intergenic
1199387071 X:147235536-147235558 GTGTGTGAGTATGTGTGTGTTGG - Intergenic
1199582556 X:149374883-149374905 GTGGTTAAGAACATGTGTTCTGG + Intergenic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1200404972 Y:2800748-2800770 GTTTTTAAAAACATGTGTCTGGG + Intergenic
1201525932 Y:14934452-14934474 GTATGTAGGAGAATGTGTGTAGG - Intergenic
1202274338 Y:23099960-23099982 ATGTGTAAGAACATAAGTGCGGG - Intergenic
1202291688 Y:23320717-23320739 ATGTGTAAGAACATAAGTGCGGG + Intergenic
1202427333 Y:24733705-24733727 ATGTGTAAGAACATAAGTGCGGG - Intergenic
1202443458 Y:24936389-24936411 ATGTGTAAGAACATAAGTGCGGG + Intergenic